Galactoside 2 alpha L fucosyltransferase 1 (FUT1) (NM_000148) Human Untagged Clone

CAT#: SC300016

FUT1 (untagged)-Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1)


  "NM_000148" in other vectors (6)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "FUT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FUT1
Synonyms H; HH; HSC
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_000148 edited
AAAAGCGGACTGTGGATCTGCCACCTGCAAGCAGCTCGGCCATGTGGCTCCGGAGCCATC
GTCAGCTCTGCCTGGCCTTCCTGCTAGTCTGTGTCCTCTCTGTAATCTTCTTCCTCCATA
TCCATCAAGACAGCTTTCCACATGGCCTAGGCCTGTCGATCCTGTGTCCAGACCGCCGCC
TGGTGACACCCCCAGTGGCCATCTTCTGCCTGCCGGGTACTGCGATGGGCCCCAACGCCT
CCTCTTCCTGTCCCCAGCACCCTGCTTCCCTCTCCGGCACCTGGACTGTCTACCCCAATG
GCCGGTTTGGTAATCAGATGGGACAGTATGCCACGCTGCTGGCTCTGGCCCAGCTCAACG
GCCGCCGGGCCTTTATCCTGCCTGCCATGCATGCCGCCCTGGCCCCGGTATTCCGCATCA
CCCTGCCCGTGCTGGCCCCAGAAGTGGACAGCCGCACGCCGTGGCGGGAGCTGCAGCTTC
ACGACTGGATGTCGGAGGAGTACGCGGACTTGAGAGATCCTTTCCTGAAGCTCTCTGGCT
TCCCCTGCTCTTGGACTTTCTTCCACCATCTCCGGGAACAGATCCGCAGAGAGTTCACCC
TGCACGACCACCTTCGGGAAGAGGCGCAGAGTGTGCTGGGTCAGCTCCGCCTGGGCCGCA
CAGGGGACCGCCCGCGCACCTTTGTCGGCGTCCACGTGCGCCGTGGGGACTATCTGCAGG
TTATGCCTCAGCGCTGGAAGGGTGTGGTGGGCGACAGCGCCTACCTCCGGCAGGCCATGG
ACTGGTTCCGGGCACGGCACGAAGCCCCCGTTTTCGTGGTCACCAGCAACGGCATGGAGT
GGTGTAAAGAAAACATCGACACCTCCCAGGGCGATGTGACGTTTGCTGGCGATGGACAGG
AGGCTACACCGTGGAAAGACTTTGCCCTGCTCACACAGTGCAACCACACCATTATGACCA
TTGGCACCTTCGGCTTCTGGGCTGCCTACCTGGCTGGCGGAGACACTGTCTACCTGGCCA
ACTTCACCCTGCCAGACTCTGAGTTCCTGAAGATCTTTAAGCCGGAGGCGGCCTTCCTGC
CCGAGTGGGTGGGCATTAATGCAGACTTGTCTCCACTCTGGACATTGGCTAAGCCTTGAG
AGCCAGGGAGACTTTCTGA
Restriction Sites Please inquire     
ACCN NM_000148
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000148.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000148.2, NP_000139.1
RefSeq Size 4244 bp
RefSeq ORF 1098 bp
Locus ID 2523
Cytogenetics 19q13.33
Protein Families Druggable Genome, Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - globo series, Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
Gene Summary 'This gene encodes a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the synthesis of soluble A and B antigens. This is one of two genes encoding the galactoside 2-L-fucosyltransferase enzyme. Mutations in this gene are a cause of the H-Bombay blood group. [provided by RefSeq, Aug 2016]'
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.