Amylin (IAPP) (NM_000415) Human Untagged Clone

CAT#: SC300065

IAPP (untagged)-Human islet amyloid polypeptide (IAPP)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IAPP
• Synonyms: DAP; IAP
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_000415 edited
  ATGGGCATCCTGAAGCTGCAAGTATTTCTCATTGTGCTCTCTGTTGCATTGAACCATCTG
  AAAGCTACACCCATTGAAAGTCATCAGGTGGAAAAGCGGAAATGCAACACTGCCACATGT
  GCAACGCAGCGCCTGGCAAATTTTTTAGTTCATTCCAGCAACAACTTTGGTGCCATTCTC
  TCATCTACCAACGTGGGATCCAATACATATGGCAAGAGGAATGCAGTAGAGGTTTTAAAG
  AGAGAGCCACTGAATTACTTGCCCCTTTAG
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_000415 unedited
  NGGTCAGTCAAATTTTGTATACGACTCATATAGGGCGGCCGCGATTCGCCCTTTGCTGAC
  TTGAAACATTAAAAGAAAATTGAGAAGCAATGGGCATCCTGAAGCTGCAAGTATTTCTCA
  TTGTGCTCTCTGTTGCATTGAACCATCTGAAAGCTACACCCATTGAAAGTCATCAGGTGG
  AAAAGCGGAAATGCAACACTGCCACATGTGCAACGCAGCGCCTGGCAAATTTTTTAGTTC
  ATTCCAGCAACAACTTTGGTGCCATTCTCTCATCTACCAACGTGGGATCCAATACATATG
  GCAAGAGGAATGCAGTAGAGGTTTTAAAGAGAGAGCCACTGAATTACTTGCCCCTTTAGA
  GGACAATGTAACTCTATAGTTATTGTTTTATGTTCTAGTGATTTCCTGTATAATTTAACA
  GTGCCCTTTTCATCTCCAGTGTGAATATATGGTCTGAAGGGCGAATTCAGATCTGGTACC
  GATATCAAGCTTGTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATC
  CCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTC
  CAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGT
  CCTTCTATAATATTATGGGGTGGAGGGGGGTGGGTATGGNAGCAAGGNGCAAGNTNGGGA
  AGACAACCTGTNAGGCCCTGCGNGTCTATTGNGAACCAAGCTGGAGTGCAGTGGCACAAT
  CTTGGCTCACTGCAATCTCCGCCTTCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCG
  AGTTGTGGGGATTCCAGCATGCNATGACCAGCTCAGCTT
  
• Restriction Sites: Please inquire
• ACCN: NM_000415
• Insert Size: 400 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000415.1, NP_000406.1
• RefSeq Size: 1462 bp
• RefSeq ORF: 270 bp
• Locus ID: 3375
• Cytogenetics: 12p12.1
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Maturity onset diabetes of the young
• Gene Summary: 'This gene encodes a member of the calcitonin family of peptide hormones. This hormone is released from pancreatic beta cells following food intake to regulate blood glucose levels and act as a satiation signal. Human patients with type 1 and advanced type 2 diabetes exhibit reduced levels of the encoded hormone in blood and pancreas. This protein also exhibits a bactericidal, antimicrobial activity. [provided by RefSeq, Jul 2016]'
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.