Vasopressin (AVP) (NM_000490) Human Untagged Clone
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | AVP |
| Synonyms | ADH; ARVP; AVP-NPII; AVRP; VP |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_000490 edited
ATACGGGGTCCACCTGTGTGCACCAGGATGCCTGACACCATGCTGCCCGCCTGCTTCCTC GGCCTACTGGCCTTCTCCTCCGCGTGCTACTTCCAGAACTGCCCGAGGGGCGGCAAGAGG GCCATGTCCGACCTGGAGCTGAGACAGTGCCTCCCCTGCGGCCCCGGGGGCAAAGGCCGC TGCTTCGGGCCCAGCATCTGCTGCGCGGACGAGCTGGGCTGCTTCGTGGGCACGGCTGAG GCGCTGCGCTGCCAGGAGGAGAACTACCTGCCGTCGCCCTGCCAGTCCGGCCAGAAGGCG TGCGGGAGCGGGGGCCGCTGCGCCGCCTTCGGCGTTTGCTGCAACGACGAGAGCTGCGTG ACCGAGCCCGAGTGCCGCGAGGGCTTTCACCGCCGCGCCCGCGCCAGCGACCGGAGCAAC GCCACGCAGCTGGACGGGCCGGCCGGGGCCTTGCTGCTGCGGCTGGTGCAGCTGGCCGGG GCGCCCGAGCCCTTCGAGCCCGCCCAGCCCGACGCCTACTGAGCCCCGCGCTCGCCCCAC CGGCGCGCTCTTCGCGCCCGCCCCTGCAGCACGGACAATAAACCTCCGCCA |
| Restriction Sites | Please inquire |
| ACCN | NM_000490 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000490. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_000490.3, NP_000481.2 |
| RefSeq Size | 633 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 551 |
| Cytogenetics | 20p13 |
| Protein Families | Druggable Genome, Secreted Protein |
| Gene Summary | 'This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin is a posterior pituitary hormone that is synthesized in the supraoptic nucleus and paraventricular nucleus of the hypothalamus. Along with its carrier protein, neurophysin 2, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis where it is either stored or secreted into the bloodstream. The precursor is thought to be activated while it is being transported along the axon to the posterior pituitary. Arginine vasopressin acts as a growth factor by enhancing pH regulation through acid-base transport systems. It has a direct antidiuretic action on the kidney, and also causes vasoconstriction of the peripheral vessels. This hormone can contract smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. Mutations in this gene cause autosomal dominant neurohypophyseal diabetes insipidus (ADNDI). This gene is present in a gene cluster with the related gene oxytocin on chromosome 20. [provided by RefSeq, Nov 2015]' |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216816 | AVP (Myc-DDK-tagged)-Human arginine vasopressin (AVP) |
USD 150.00 |
|
| RG216816 | AVP (GFP-tagged) - Human arginine vasopressin (AVP) |
USD 460.00 |
|
| RC216816L1 | Lenti ORF clone of Human arginine vasopressin (AVP), Myc-DDK-tagged |
USD 768.00 |
|
| RC216816L2 | Lenti ORF clone of Human arginine vasopressin (AVP), mGFP tagged |
USD 620.00 |
|
| RC216816L3 | Lenti ORF clone of Human arginine vasopressin (AVP), Myc-DDK-tagged |
USD 620.00 |
|
| RC216816L4 | Lenti ORF clone of Human arginine vasopressin (AVP), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China