FSH beta (FSHB) (NM_000510) Human Untagged Clone

CAT#: SC300085

FSHB (untagged)-Human follicle stimulating hormone, beta polypeptide (FSHB), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FSHB
• Synonyms: HH24
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000510 edited
  ATGAAGACACTCCAGTTTTTCTTCCTTTTCTGTTGCTGGAAAGCAATCTGCTGCAATAGC
  TGTGAGCTGACCAACATCACCATTGCAATAGAGAAAGAAGAATGTCGTTTCTGCATAAGC
  ATCAACACCACTTGGTGTGCTGGCTACTGCTACACCAGGGATCTGGTGTATAAGGACCCA
  GCCAGGCCCAAAATCCAGAAAACATGTACCTTCAAGGAACTGGTATACGAAACAGTGAGA
  GTGCCCGGCTGTGCTCACCATGCAGATTCCTTGTATACATACCCAGTGGCCACCCAGTGT
  CACTGTGGCAAGTGTGACAGCGACAGCACTGATTGTACTGTGCGAGGCCTGGGGCCCAGC
  TACTGCTCCTTTGGTGAAATGAAAGAATAA
  
• Restriction Sites: Please inquire
• ACCN: NM_000510
• Insert Size: 400 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: It is not a varient.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000510.2, NP_000501.1
• RefSeq Size: 1936 bp
• RefSeq ORF: 390 bp
• Locus ID: 2488
• Cytogenetics: 11p14.1
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: GnRH signaling pathway, Neuroactive ligand-receptor interaction
• Gene Summary: 'The pituitary glycoprotein hormone family includes follicle-stimulating hormone, luteinizing hormone, chorionic gonadotropin, and thyroid-stimulating hormone. All of these glycoproteins consist of an identical alpha subunit and a hormone-specific beta subunit. This gene encodes the beta subunit of follicle-stimulating hormone. In conjunction with luteinizing hormone, follicle-stimulating hormone induces egg and sperm production. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.