IL10 (NM_000572) Human Untagged Clone
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | IL10 |
| Synonyms | CSIF; GVHDS; IL-10; IL10A; TGIF |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_000572 edited
CTTGCAAAACCAAACCACAAGACAGACTTGCAAAAGAAGGCATGCACAGCTCAGCACTGC TCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCAGCCCAGGCCAGGGCACCCAGTCTG AGAACAGCTGCACCCACTTCCCAGGCAACCTGCCTAACATGCTTCGAGATCTCCGAGATG CCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAA AGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGA TCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGG CGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTC ATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTA ATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACT ACATAGAAGCCTACATGACAATGAAGATACGAAACTGAGACATCAGGGTGGCGACTCTAT AGA |
| Restriction Sites | Please inquire |
| ACCN | NM_000572 |
| Insert Size | 700 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_000572.2, NP_000563.1 |
| RefSeq Size | 1629 bp |
| RefSeq ORF | 537 bp |
| Locus ID | 3586 |
| Cytogenetics | 1q32.1 |
| Domains | IL10 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
| Protein Pathways | Allograft rejection, Asthma, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Systemic lupus erythematosus, T cell receptor signaling pathway |
| Gene Summary | 'The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. Mutations in this gene are associated with an increased susceptibility to HIV-1 infection and rheumatoid arthritis. [provided by RefSeq, May 2020]' |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216785 | IL10 (Myc-DDK-tagged)-Human interleukin 10 (IL10) |
USD 450.00 |
|
| RG216785 | IL10 (GFP-tagged) - Human interleukin 10 (IL10) |
USD 460.00 |
|
| RC216785L1 | Lenti ORF clone of Human interleukin 10 (IL10), Myc-DDK-tagged |
USD 768.00 |
|
| RC216785L2 | Lenti ORF clone of Human interleukin 10 (IL10), mGFP tagged |
USD 768.00 |
|
| RC216785L3 | Lenti ORF clone of Human interleukin 10 (IL10), Myc-DDK-tagged |
USD 620.00 |
|
| RC216785L4 | Lenti ORF clone of Human interleukin 10 (IL10), mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China