C8 (C8G) (NM_000606) Human Untagged Clone
CAT#: SC300107
C8G (untagged)-Human complement component 8, gamma polypeptide (C8G)
"NM_000606" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | C8G |
Synonyms | C8C |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_000606, the custom clone sequence may differ by one or more nucleotides
ATGCTGCCCCCTGGGACTGCGACCCTCTTGACTCTGCTCCTGGCAGCTGGCTCGCTGGGCCAGAAGCCTC AGAGGCCACGCCGGCCCGCATCCCCCATCAGCACCATCCAGCCCAAGGCCAATTTTGATGCTCAGCAGTT TGCAGGGACCTGGCTCCTTGTGGCTGTGGGCTCCGCTTGCCGTTTCCTGCAGGAGCAGGGCCACCGGGCC GAGGCCACCACACTGCATGTGGCTCCCCAGGGCACAGCCATGGCTGTCAGTACCTTCCGAAAGCTGGATG GGATCTGCTGGCAGGTGCGCCAGCTCTATGGAGACACAGGGGTCCTCGGCCGCTTCCTGCTTCAAGCCCG AGACGCCCGAGGGGCTGTGCACGTGGTTGTCGCTGAGACCGACTACCAGAGTTTCGCTGTCCTGTACCTG GAGCGGGCGGGGCAGCTGTCAGTGAAGCTCTACGCCCGCTCGCTCCCTGTGAGCGACTCGGTCCTGAGTG GGTTTGAGCAGCGGGTCCAGGAGGCCCACCTGACTGAGGACCAGATCTTCTACTTCCCCAAGTACGGCTT CTGCGAGGCTGCAGACCAGTTCCACGTCCTGGACGAAGTGAGGAGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_000606 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000606.2, NP_000597.2 |
RefSeq Size | 888 bp |
RefSeq ORF | 609 bp |
Locus ID | 733 |
Cytogenetics | 9q34.3 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Complement and coagulation cascades, Prion diseases, Systemic lupus erythematosus |
Gene Summary | 'The protein encoded by this gene belongs to the lipocalin family. It is one of the three subunits that constitutes complement component 8 (C8), which is composed of a disulfide-linked C8 alpha-gamma heterodimer and a non-covalently associated C8 beta chain. C8 participates in the formation of the membrane attack complex (MAC) on bacterial cell membranes. While subunits alpha and beta play a role in complement-mediated bacterial killing, the gamma subunit is not required for the bactericidal activity. [provided by RefSeq, Jul 2011]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222236 | C8G (Myc-DDK-tagged)-Human complement component 8, gamma polypeptide (C8G) |
USD 420.00 |
|
RG222236 | C8G (GFP-tagged) - Human complement component 8, gamma polypeptide (C8G) |
USD 460.00 |
|
RC222236L1 | Lenti ORF clone of Human complement component 8, gamma polypeptide (C8G), Myc-DDK-tagged |
USD 620.00 |
|
RC222236L2 | Lenti ORF clone of Human complement component 8, gamma polypeptide (C8G), mGFP tagged |
USD 620.00 |
|
RC222236L3 | Lenti ORF clone of Human complement component 8, gamma polypeptide (C8G), Myc-DDK-tagged |
USD 620.00 |
|
RC222236L4 | Lenti ORF clone of Human complement component 8, gamma polypeptide (C8G), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review