Gastrin (GAST) (NM_000805) Human Untagged Clone

CAT#: SC300135

GAST (untagged)-Human gastrin (GAST)


  "NM_000805" in other vectors (6)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "GAST"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GAST
Synonyms GAS
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_000805 edited
GGCACCACACACCTCCCAGCTCTGCAGACGAGATGCAGCGACTATGTGTGTATGTGCTGA
TCTTTGCACTGGCTCTGGCCGCCTTCTCTGAAGCTTCTTGGAAGCCCCGCTCCCAGCAGC
CAGATGCACCCTTAGGTACAGGGGCCAACAGGGACCTGGAGCTACCCTGGCTGGAGCAGC
AGGGCCCAGCCTCTCATCATCGAAGGCAGCTGGGACCCCAGGGTCCCCCACACCTCGTGG
CAGACCCGTCCAAGAAGCAGGGACCATGGCTGGAGGAAGAAGAAGAAGCCTATGGATGGA
TGGACTTCGGCCGCCGCAGTGCTGAGGATGAGAACTAACAATCCTAGAACCAAGCTTCAG
AGCCTAGCCACCTCCCACCCCACTCCAGCCCTGTCCCCTGAAAAACTGAT
Restriction Sites Please inquire     
ACCN NM_000805
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000805.3.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000805.3, NP_000796.1
RefSeq Size 440 bp
RefSeq ORF 306 bp
Locus ID 2520
Cytogenetics 17q21.2
Protein Families Druggable Genome, Secreted Protein
Gene Summary 'Gastrin is a hormone whose main function is to stimulate secretion of hydrochloric acid by the gastric mucosa, which results in gastrin formation inhibition. This hormone also acts as a mitogenic factor for gastrointestinal epithelial cells. Gastrin has two biologically active peptide forms, G34 and G17. [provided by RefSeq, Jul 2008]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.