Syntaxin 16 (STX16) (NM_001001433) Human Untagged Clone

CAT#: SC300188

STX16 (untagged)-Human syntaxin 16 (STX16), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STX16
• Synonyms: SYN16
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001001433, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGT
  TAGCCGAGCAAGTGAGTAGTCACATCACCTCCAGCCCTCTGCATTCACGTAGCATTGCTGCGGAGCTGGA
  CGAGCTTGCTGATGACCGTATGGCACTGGTGTCAGGCATCAGCTTAGATCCAGAAGCAGCGATTGGTGTG
  ACAAAACGGCCACCTCCTAAGTGGGTGGATGGAGTGGATGAAATTCAGTATGATGTTGGCCGGATTAAGC
  AGAAGATGAAAGAATTGGCCAGCCTTCATGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGCGA
  AGAGGAACATGCCATTGAGATAACTACCCAAGAGATCACTCAGCTCTTCCACAGGTGCCAGCGTGCCGTG
  CAGGCCCTGCCGAGCCGGGCCCGGGCCTGCTCCGAGCAGGAGGGGCGGCTGCTTGGGAACGTGGTGGCCT
  CGCTGGCGCAGGCCCTGCAGGAACTCTCCACCAGCTTCCGGCACGCACAGTCAGGCTACCTCAAACGCAT
  GAAGAATCGAGAGGAAAGATCCCAGCATTTTTTCGACACATCAGTACCACTAATGGATGATGGAGACGAT
  AACACTCTTTACCATCGGGGTTTTACAGAGGACCAGTTAGTTCTGGTGGAGCAGAACACACTGATGGTGG
  AAGAGCGGGAACGAGAGATTCGCCAGATTGTACAGTCCATTTCTGACCTGAATGAAATATTCAGGGACTT
  AGGGGCGATGATTGTAGAACAGGGTACAGTCCTTGACAGAATTGACTATAACGTTGAACAGTCCTGTATC
  AAAACTGAAGATGGTTTGAAACAGCTTCACAAGGCAGAACAGTATCAAAAGAAGAATCGGAAGATGCTTG
  TGATTTTAATATTATTTGTCATCATCATTGTGCTCATTGTTGTCCTCGTTGGCGTGAAGTCTCGATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001001433
• ORF Size: 978 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001001433.2, NP_001001433.1
• RefSeq Size: 4978
• RefSeq ORF: 978
• Locus ID: 8675
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• Gene Summary: This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a, also referred to as isoform B). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.