UBE2W (NM_001001481) Human Untagged Clone

CAT#: SC300195

UBE2W (untagged)-Human ubiquitin-conjugating enzyme E2W (putative) (UBE2W), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBE2W
• Synonyms: UBC-16; UBC16
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001001481, the custom clone sequence may differ by one or more nucleotides
  ATGGCGTCAATGCAGACCACAGGAAGGAGGGTGGAAGTATGGTTTCCAAAACGACTACAG
  AAAGAACTGTTGGCTTTGCAAAATGACCCACCTCCTGGAATGACCTTAAATGAGAAGAGT
  GTTCAAAATTCAATTACACAGTGGATTGTAGACATGGAAGGTGCACCAGGTACCTTATAT
  GAAGGGGAAAAATTTCAACTTCTATTTAAATTTAGTAGTCGATATCCTTTTGACTCTCCT
  CAGGTCATGTTTACTGGTGAAAATATTCCTGTTCATCCTCATGTTTATAGCAATGGTCAT
  ATCTGTTTATCCATTCTAACAGAAGACTGGTCCCCAGCGCTCTCAGTCCAATCAGTTTGT
  CTTAGCATTATTAGCATGCTTTCCAGCTGCAAGGAAAAGAGACGACCACCGGATAATTCT
  TTTTATGTGCGAACATGTAACAAGAATCCAAAGAAAACAAAATGGTGGTATCATGATGAT
  ACTTGTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001001481
• ORF Size: 489 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001001481.1, NP_001001481.1
• RefSeq Size: 4057
• RefSeq ORF: 489
• Locus ID: 55284
• Protein Families: Transcription Factors
• Protein Pathways: Ubiquitin mediated proteolysis
• Gene Summary: This gene encodes a nuclear-localized ubiquitin-conjugating enzyme (E2) that, along with ubiquitin-activating (E1) and ligating (E3) enzymes, coordinates the addition of a ubiquitin moiety to existing proteins. The encoded protein promotes the ubiquitination of Fanconi anemia complementation group proteins and may be important in the repair of DNA damage. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.