beta Synuclein (SNCB) (NM_001001502) Human Untagged Clone
CAT#: SC300202
SNCB (untagged)-Human synuclein, beta (SNCB), transcript variant 1
"NM_001001502" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SNCB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001001502, the custom clone sequence may differ by one or more nucleotides
ATGGACGTGTTCATGAAGGGCCTGTCCATGGCCAAGGAGGGCGTTGTGGCAGCCGCGGAGAAAACCAAGC AGGGGGTCACCGAGGCGGCGGAGAAGACCAAGGAGGGCGTCCTCTACGTCGGAAGCAAGACCCGAGAAGG TGTGGTACAAGGTGTGGCTTCAGTGGCTGAAAAAACCAAGGAACAGGCCTCACATCTGGGAGGAGCTGTG TTCTCTGGGGCAGGGAACATCGCAGCAGCCACAGGACTGGTGAAGAGGGAGGAATTCCCTACTGATCTGA AGCCAGAGGAAGTGGCCCAGGAAGCTGCTGAAGAACCACTGATTGAGCCCCTGATGGAGCCAGAAGGGGA GAGTTATGAGGACCCACCCCAGGAGGAATATCAGGAGTATGAGCCAGAGGCGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001001502 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001502.2, NP_001001502.1 |
RefSeq Size | 1594 bp |
RefSeq ORF | 405 bp |
Locus ID | 6620 |
Cytogenetics | 5q35.2 |
Gene Summary | 'This gene encodes a member of a small family of proteins that inhibit phospholipase D2 and may function in neuronal plasticity. The encoded protein is abundant in lesions of patients with Alzheimer disease. A mutation in this gene was found in individuals with dementia with Lewy bodies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]' Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Variants 1, 2 and 7 encode the same protein (isoform 1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215165 | SNCB (Myc-DDK-tagged)-Human synuclein, beta (SNCB), transcript variant 1 |
USD 98.00 |
|
RG215165 | SNCB (GFP-tagged) - Human synuclein, beta (SNCB), transcript variant 1 |
USD 460.00 |
|
RC215165L3 | Lenti ORF clone of Human synuclein, beta (SNCB), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC215165L4 | Lenti ORF clone of Human synuclein, beta (SNCB), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review