GRB10 (NM_001001549) Human Untagged Clone
CAT#: SC300211
GRB10 (untagged)-Human growth factor receptor-bound protein 10 (GRB10), transcript variant 2
"NM_001001549" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GRB10 |
Synonyms | Grb-10; GRB-IR; IRBP; MEG1; RSS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001001549, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTAGCCGGCTGCCCAGATTCCTTTTTGCACCATCCGTACTACCAGGACAAGGTGGAGCAGACAC CTCGCAGTCAACAAGACCCGGCAGGACCAGGACTCCCCGCACAGTCTGACCGACTTGCGAATCACCAGGA GGATGATGTGGACCTGGAAGCCCTGGTGAACGATATGAATGCATCCCTGGAGAGCCTGTACTCGGCCTGC AGCATGCAGTCAGACACGGTGCCCCTCCTGCAGAATGGCCAGCATGCCCGCAGCCAGCCTCGGGCTTCAG GCCCTCCTCGGTCCATCCAGCCACAGGTGTCCCCGAGGCAGAGGGTGCAGCGCTCCCAGCCTGTGCACAT CCTCGCTGTCAGGCGCCTTCAGGAGGAAGACCAGCAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAAT CCTTTTCCTGAACTCTGTGGCCCTGGGAGCCCCCCTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGG CCGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGAAGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGA CATGACAGCCAGAGACCTGTGCCAATTGCTGGTTTACAAAAGTCACTGTGTGGATGACAACAGCTGGACA CTAGTGGAGCACCACCCGCACCTAGGATTAGAGAGGTGCTTGGAAGACCATGAGCTGGTGGTCCAGGTGG AGAGTACCATGGCCAGTGAGAGTAAATTTCTATTCAGGAAGAATTACGCAAAATACGAGTTCTTTAAAAA TCCCATGAATTTCTTCCCAGAACAGATGGTTACTTGGTGCCAGCAGTCAAATGGCAGTCAAACCCAGCTT TTGCAGGAACCCAGACACCTGCAGCTGCTGGCCGACCTGGAGGACAGCAACATCTTCTCCCTGATCGCTG GCAGGAAGCAGTACAACGCCCCTACAGACCACGGGCTCTGCATAAAGCCAAACAAAGTCAGGAATGAAAC TAAAGAGCTGAGGTTGCTCTGTGCAGAGGACGAGCAAACCAGGACGTGCTGGATGACAGCGTTCAGACTC CTCAAGTATGGAATGCTCCTTTACCAGAATTACCGAATCCCTCAGCAGAGGAAGGCCTTGCTGTCCCCGT TCTCGACGCCAGTGCGCAGTGTCTCCGAGAACTCCCTCGTGGCAATGGATTTTTCTGGGCAAACAGGACG CGTGATAGAGAATCCGGCGGAGGCCCAGAGCGCAGCCCTGGAGGAGGGCCACGCCTGGAGGAAGCGAAGC ACACGGATGAACATCCTAGGTAGCCAAAGTCCCCTCCACCCTTCTACCCTAAGTACAGTGATTCACAGGA CACAGCACTGGTTTCACGGGAGGATCTCCAGGGAGGAATCCCACAGGATCATTAAACAGCAAGGGCTCGT GGATGGGCTTTTTCTCCTCCGTGACAGCCAGAGTAATCCAAAGGCATTTGTACTCACACTGTGTCATCAC CAGAAAATTAAAAATTTCCAGATCTTACCTTGCGAGGACGACGGGCAGACGTTCTTCAGCCTAGATGACG GGAACACCAAATTCTCTGACCTGATCCAGCTGGTTGACTTTTACCAGCTGAACAAAGGAGTCCTGCCTTG CAAACTCAAGCACCACTGCATCCGAGTGGCCTTATGA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001001549 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001549.2, NP_001001549.1 |
RefSeq Size | 4575 bp |
RefSeq ORF | 1647 bp |
Locus ID | 2887 |
Cytogenetics | 7p12.1 |
Protein Families | Druggable Genome |
Gene Summary | 'The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. Overexpression of some isoforms of the encoded protein inhibits tyrosine kinase activity and results in growth suppression. This gene is imprinted in a highly isoform- and tissue-specific manner, with expression observed from the paternal allele in the brain, and from the maternal allele in the placental trophoblasts. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]' Transcript Variant: This variant (2), also known as hGrb10alpha, lacks an in-frame segment in the coding region, compared to variant 1. It encodes a shorter isoform (b), that is missing an internal segment compared to isoform a. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220779 | GRB10 (Myc-DDK-tagged)-Human growth factor receptor-bound protein 10 (GRB10), transcript variant 2 |
USD 480.00 |
|
RG220779 | GRB10 (GFP-tagged) - Human growth factor receptor-bound protein 10 (GRB10), transcript variant 2 |
USD 530.00 |
|
RC220779L3 | Lenti-ORF clone of GRB10 (Myc-DDK-tagged)-Human growth factor receptor-bound protein 10 (GRB10), transcript variant 2 |
USD 680.00 |
|
RC220779L4 | Lenti-ORF clone of GRB10 (mGFP-tagged)-Human growth factor receptor-bound protein 10 (GRB10), transcript variant 2 |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review