GRB10 (NM_001001555) Human Untagged Clone

CAT#: SC300215

GRB10 (untagged)-Human growth factor receptor-bound protein 10 (GRB10), transcript variant 4


  "NM_001001555" in other vectors (5)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GRB10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GRB10
Synonyms Grb-10; GRB-IR; IRBP; MEG1; RSS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001001555, the custom clone sequence may differ by one or more nucleotides


ATGAATGCATCCCTGGAGAGCCTGTACTCGGCCTGCAGCATGCAGTCAGACACGGTGCCCCTCCTGCAGA
ATGGCCAGCATGCCCGCAGCCAGCCTCGGGCTTCAGGCCCTCCTCGGTCCATCCAGCCACAGGTGTCCCC
GAGGCAGAGGGTGCAGCGCTCCCAGCCTGTGCACATCCTCGCTGTCAGGCGCCTTCAGGAGGAAGACCAG
CAGTTTAGAACCTCATCTCTGCCGGCCATCCCCAATCCTTTTCCTGAACTCTGTGGCCCTGGGAGCCCCC
CTGTGCTCACGCCGGGTTCTTTACCTCCGAGCCAGGCCGCCGCAAAGCAGGATGTTAAAGTCTTTAGTGA
AGATGGGACAAGCAAAGTGGTGGAGATTCTAGCAGACATGACAGCCAGAGACCTGTGCCAATTGCTGGTT
TACAAAAGTCACTGTGTGGATGACAACAGCTGGACACTAGTGGAGCACCACCCGCACCTAGGATTAGAGA
GGTGCTTGGAAGACCATGAGCTGGTGGTCCAGGTGGAGAGTACCATGGCCAGTGAGAGTAAATTTCTATT
CAGGAAGAATTACGCAAAATACGAGTTCTTTAAAAATCCCATGAATTTCTTCCCAGAACAGATGGTTACT
TGGTGCCAGCAGTCAAATGGCAGTCAAACCCAGCTTTTGCAGAATTTTCTGAACTCCAGTAGTTGTCCTG
AAATTCAAGGGTTTTTGCATGTGAAAGAGCTGGGAAAGAAATCATGGAAAAAGCTGTATGTGTGTTTGCG
GAGATCTGGCCTTTATTGCTCCACCAAGGGAACTTCAAAGGAACCCAGACACCTGCAGCTGCTGGCCGAC
CTGGAGGACAGCAACATCTTCTCCCTGATCGCTGGCAGGAAGCAGTACAACGCCCCTACAGACCACGGGC
TCTGCATAAAGCCAAACAAAGTCAGGAATGAAACTAAAGAGCTGAGGTTGCTCTGTGCAGAGGACGAGCA
AACCAGGACGTGCTGGATGACAGCGTTCAGACTCCTCAAGTATGGAATGCTCCTTTACCAGAATTACCGA
ATCCCTCAGCAGAGGAAGGCCTTGCTGTCCCCGTTCTCGACGCCAGTGCGCAGTGTCTCCGAGAACTCCC
TCGTGGCAATGGATTTTTCTGGGCAAACAGGACGCGTGATAGAGAATCCGGCGGAGGCCCAGAGCGCAGC
CCTGGAGGAGGGCCACGCCTGGAGGAAGCGAAGCACACGGATGAACATCCTAGGTAGCCAAAGTCCCCTC
CACCCTTCTACCCTAAGTACAGTGATTCACAGGACACAGCACTGGTTTCACGGGAGGATCTCCAGGGAGG
AATCCCACAGGATCATTAAACAGCAAGGGCTCGTGGATGGGCTTTTTCTCCTCCGTGACAGCCAGAGTAA
TCCAAAGGCATTTGTACTCACACTGTGTCATCACCAGAAAATTAAAAATTTCCAGATCTTACCTTGCGAG
GACGACGGGCAGACGTTCTTCAGCCTAGATGACGGGAACACCAAATTCTCTGACCTGATCCAGCTGGTTG
ACTTTTACCAGCTGAACAAAGGAGTCCTGCCTTGCAAACTCAAGCACCACTGCATCCGAGTGGCCTTATG
A


Restriction Sites SgfI-RsrII     
ACCN NM_001001555
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001001555.2, NP_001001555.1
RefSeq Size 5040 bp
RefSeq ORF 1611 bp
Locus ID 2887
Cytogenetics 7p12.1
Protein Families Druggable Genome
Gene Summary 'The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. Overexpression of some isoforms of the encoded protein inhibits tyrosine kinase activity and results in growth suppression. This gene is imprinted in a highly isoform- and tissue-specific manner, with expression observed from the paternal allele in the brain, and from the maternal allele in the placental trophoblasts. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2010]'
Transcript Variant: This variant (4) differs in the 5' UTR and the 5' coding region, compared to variant 1. The resulting isoform (c) has a shorter N-terminus when compared to isoform a. Isoform c is encoded by transcript variants 3 and 4.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.