TIMM50 (NM_001001563) Human Untagged Clone

CAT#: SC300219

TIMM50 (untagged)-Human translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) (TIMM50), nuclear gene encoding mitochondrial protein


  "NM_001001563" in other vectors (6)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TIMM50"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TIMM50
Synonyms MGCA9; TIM50; TIM50L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001001563, the custom clone sequence may differ by one or more nucleotides


ATGGCCTCAGCTTTATCTCTGGGCAATAAGTGTGATCCCTTCCTTCGCTGCGTCCTTTGCAGGGGCGGTG
GCGCTCTGCAAGGCCCAAGGGGGCGTGGTCCAGATGACTTTGAATCCCAGTTGTCGCCCCCAGGGTCAGC
CAGGAGACTAGTCAGAAGCAAACGCGCCTGCGGCAATCCGCCCGATGCCTTTGGTCTCTCTCGGGCTTCC
GTCCACCCGCCCCTCCCCCGCGTTTCCATTGGCTGTAGCTCCGGCCCGGGGCGGGCGAAGAGGGAGCGAG
TGGGCGGGGCCGCGTGGCGTCAGCGCAAGATGGCGGCCTCGGCAGCGGTGTTCTCGCGCTTGCGAAGCGG
GCTCCGGCTCGGCTCGCGGGGACTGTGCACGAGGTTGGCGACGCCGCCCCGCCGGGCCCCAGATCAGGCC
GCAGAGATCGGGAGCCGCGGGAGCACTAAGGCGCAAGGGCCACAGCAGCAGCCGGGCTCAGAGGGTCCCA
GCTATGCCAAAAAAGTTGCGCTCTGGCTTGCTGGGCTGCTTGGAGCTGGTGGGACTGTGAGCGTCGTCTA
TATCTTTGGAAACAACCCGGTGGACGAAAATGGTGCCAAGATTCCTGATGAGTTCGACAATGATCCAATT
CTGGTACAGCAGTTGCGCCGGACATACAAATATTTCAAAGATTATAGACAGATGATCATCGAGCCCACCA
GCCCTTGCCTTCTCCCAGACCCTCTGCAGGAACCGTACTACCAGCCACCCTACACGCTCGTTTTGGAGCT
CACCGGCGTCCTCTTGCATCCTGAGTGGTCGCTGGCCACTGGCTGGAGGTTTAAGAAGCGCCCAGGCATC
GAGACCTTGTTCCAGCAGCTTGCCCCTTTATATGAAATTGTCATCTTTACGTCAGAGACTGGCATGACTG
CGTTTCCACTCATTGATAGTGTGGACCCCCATGGCTTCATCTCCTACCGCCTATTCCGGGACGCCACAAG
ATACATGGATGGACACCATGTAAAGGATATTTCATGTCTGAATCGGGACCCAGCTCGAGTAGTAGTTGTG
GACTGCAAGAAGGAAGCCTTCCGCCTGCAGCCCTATAACGGCGTTGCCCTGCGGCCCTGGGACGGCAACT
CTGATGACCGGGTCTTGTTGGATCTGTCTGCCTTCCTCAAGACCATTGCACTGAATGGTGTGGAGGACGT
GCGAACCGTGCTGGAGCACTATGCCCTGGAGGATGACCCGCTGGCGGCTTTCAAACAGCGGCAAAGCCGG
CTAGAGCAGGAGGAGCAGCAGCGCCTGGCCGAGCTCTCCAAGTCCAACAAGCAGAACCTCTTCCTTGGCT
CCCTCACCAGCCGCTTGTGGCCTCGCTCCAAACAGCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001001563
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001001563.3, NP_001001563.1
RefSeq Size 5481 bp
RefSeq ORF 1371 bp
Locus ID 92609
Cytogenetics 19q13.2
Gene Summary This gene encodes a subunit of the TIM23 inner mitochondrial membrane translocase complex. The encoded protein functions as the receptor subunit that recognizes the mitochondrial targeting signal, or presequence, on protein cargo that is destined for the mitochondrial inner membrane and matrix. This protein may also play a role in maintaining the membrane permeability barrier, and knockdown of this gene in human cells results in the release of cytochrome c and apoptosis. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.