TIMM50 (NM_001001563) Human Untagged Clone
CAT#: SC300219
TIMM50 (untagged)-Human translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) (TIMM50), nuclear gene encoding mitochondrial protein
"NM_001001563" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TIMM50 |
Synonyms | MGCA9; TIM50; TIM50L |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001001563, the custom clone sequence may differ by one or more nucleotides
ATGGCCTCAGCTTTATCTCTGGGCAATAAGTGTGATCCCTTCCTTCGCTGCGTCCTTTGCAGGGGCGGTG GCGCTCTGCAAGGCCCAAGGGGGCGTGGTCCAGATGACTTTGAATCCCAGTTGTCGCCCCCAGGGTCAGC CAGGAGACTAGTCAGAAGCAAACGCGCCTGCGGCAATCCGCCCGATGCCTTTGGTCTCTCTCGGGCTTCC GTCCACCCGCCCCTCCCCCGCGTTTCCATTGGCTGTAGCTCCGGCCCGGGGCGGGCGAAGAGGGAGCGAG TGGGCGGGGCCGCGTGGCGTCAGCGCAAGATGGCGGCCTCGGCAGCGGTGTTCTCGCGCTTGCGAAGCGG GCTCCGGCTCGGCTCGCGGGGACTGTGCACGAGGTTGGCGACGCCGCCCCGCCGGGCCCCAGATCAGGCC GCAGAGATCGGGAGCCGCGGGAGCACTAAGGCGCAAGGGCCACAGCAGCAGCCGGGCTCAGAGGGTCCCA GCTATGCCAAAAAAGTTGCGCTCTGGCTTGCTGGGCTGCTTGGAGCTGGTGGGACTGTGAGCGTCGTCTA TATCTTTGGAAACAACCCGGTGGACGAAAATGGTGCCAAGATTCCTGATGAGTTCGACAATGATCCAATT CTGGTACAGCAGTTGCGCCGGACATACAAATATTTCAAAGATTATAGACAGATGATCATCGAGCCCACCA GCCCTTGCCTTCTCCCAGACCCTCTGCAGGAACCGTACTACCAGCCACCCTACACGCTCGTTTTGGAGCT CACCGGCGTCCTCTTGCATCCTGAGTGGTCGCTGGCCACTGGCTGGAGGTTTAAGAAGCGCCCAGGCATC GAGACCTTGTTCCAGCAGCTTGCCCCTTTATATGAAATTGTCATCTTTACGTCAGAGACTGGCATGACTG CGTTTCCACTCATTGATAGTGTGGACCCCCATGGCTTCATCTCCTACCGCCTATTCCGGGACGCCACAAG ATACATGGATGGACACCATGTAAAGGATATTTCATGTCTGAATCGGGACCCAGCTCGAGTAGTAGTTGTG GACTGCAAGAAGGAAGCCTTCCGCCTGCAGCCCTATAACGGCGTTGCCCTGCGGCCCTGGGACGGCAACT CTGATGACCGGGTCTTGTTGGATCTGTCTGCCTTCCTCAAGACCATTGCACTGAATGGTGTGGAGGACGT GCGAACCGTGCTGGAGCACTATGCCCTGGAGGATGACCCGCTGGCGGCTTTCAAACAGCGGCAAAGCCGG CTAGAGCAGGAGGAGCAGCAGCGCCTGGCCGAGCTCTCCAAGTCCAACAAGCAGAACCTCTTCCTTGGCT CCCTCACCAGCCGCTTGTGGCCTCGCTCCAAACAGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001001563 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001563.3, NP_001001563.1 |
RefSeq Size | 5481 bp |
RefSeq ORF | 1371 bp |
Locus ID | 92609 |
Cytogenetics | 19q13.2 |
Gene Summary | This gene encodes a subunit of the TIM23 inner mitochondrial membrane translocase complex. The encoded protein functions as the receptor subunit that recognizes the mitochondrial targeting signal, or presequence, on protein cargo that is destined for the mitochondrial inner membrane and matrix. This protein may also play a role in maintaining the membrane permeability barrier, and knockdown of this gene in human cells results in the release of cytochrome c and apoptosis. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224744 | TIMM50 (Myc-DDK-tagged)-Human translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) (TIMM50), nuclear gene encoding mitochondrial protein |
USD 420.00 |
|
RG224744 | TIMM50 (GFP-tagged) - Human translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) (TIMM50), nuclear gene encoding mitochondrial protein |
USD 460.00 |
|
RC224744L1 | Lenti ORF clone of Human translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) (TIMM50), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 768.00 |
|
RC224744L2 | Lenti ORF clone of Human translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) (TIMM50), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
|
RC224744L3 | Lenti ORF clone of Human translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) (TIMM50), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 620.00 |
|
RC224744L4 | Lenti ORF clone of Human translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae) (TIMM50), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review