PPAR alpha (PPARA) (NM_001001928) Human Untagged Clone

CAT#: SC300346

PPARA (untagged)-Human peroxisome proliferator-activated receptor alpha (PPARA), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPARA
• Synonyms: hPPAR; NR1C1; PPAR; PPARalpha
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001001928 edited
  ATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAG
  AGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCGCAATCC
  ATCGGCGAGGATAGTTCTGGAAGCTTTGGCTTTACGGAATACCAGTATTTAGGAAGCTGT
  CCTGGCTCAGATGGCTCGGTCATCACGGACACGCTTTCACCAGCTTCGAGCCCCTCCTCG
  GTGACTTATCCTGTGGTCCCCGGCAGCGTGGACGAGTCTCCCAGTGGAGCATTGAACATC
  GAATGTAGAATCTGCGGGGACAAGGCCTCAGGCTATCATTACGGAGTCCACGCGTGTGAA
  GGCTGCAAGGGCTTCTTTCGGCGAACGATTCGACTCAAGCTGGTGTATGACAAGTGCGAC
  CGCAGCTGCAAGATCCAGAAAAAGAACAGAAACAAATGCCAGTATTGTCGATTTCACAAG
  TGCCTTTCTGTCGGGATGTCACACAACGCGATTCGTTTTGGACGAATGCCAAGATCTGAG
  AAAGCAAAACTGAAAGCAGAAATTCTTACCTGTGAACATGACATAGAAGATTCTGAAACT
  GCAGATCTCAAATCTCTGGCCAAGAGAATCTACGAGGCCTACTTGAAGAACTTCAACATG
  AACAAGGTCAAAGCCCGGGTCATCCTCTCAGGAAAGGCCAGTAACAATCCACCTTTTGTC
  ATACATGATATGGAGACACTGTGTATGGCTGAGAAGACGCTGGTGGCCAAGCTGGTGGCC
  AATGGCATCCAGAACAAGGAGGCGGAGGTCCGCATCTTTCACTGCTGCCAGTGCACGTCA
  GTGGAGACCGTCACGGAGCTCACGGAATTCGCCAAGGCCATCCCAGGCTTCGCAAACTTG
  GACCTGAACGATCAAGTGACATTGCTAAAATACGGAGTTTATGAGGCCATATTCGCCATG
  CTGTCTTCTGTGATGAACAAAGACGGGATGCTGGTAGCGTATGGAAATGGGTTTATAACT
  CGTGAATTCCTAAAAAGCCTAAGGAAACCGTTCTGTGATATCATGGAACCCAAGTTTGAT
  TTTGCCATGAAGTTCAATGCACTGGAACTGGATGACAGTGATATCTCCCTTTTTGTGGCT
  GCTATCATTTGCTGTGGAGATCGTCCTGGCCTTCTAAACGTAGGACACATTGAAAAAATG
  CAGGAGGGTATTGTACATGTGCTCAGACTCCACCTGCAGAGCAACCACCCGGACGATATC
  TTTCTCTTCCCAAAACTTCTTCAAAAAATGGCAGACCTCCGGCAGCTGGTGACGGAGCAT
  GCGCAGCTGGTGCAGATCATCAAGAAGACGGAGTCGGATGCTGCGCTGCACCCGCTACTG
  CAGGAGATCTACAGGGACATGTACTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001001928
• Insert Size: 1400 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001001928.2.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001001928.2, NP_001001928.1
• RefSeq Size: 9965 bp
• RefSeq ORF: 1407 bp
• Locus ID: 5465
• Cytogenetics: 22q13.31
• Protein Families: Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
• Protein Pathways: Adipocytokine signaling pathway, PPAR signaling pathway
• Gene Summary: 'Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 5. Variants 3 and 5 encode the same protein.