Claudin18 (CLDN18) (NM_001002026) Human Untagged Clone

CAT#: SC300395

CLDN18 (untagged)-Human claudin 18 (CLDN18), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN18
• Synonyms: SFTA5; SFTPJ
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001002026 edited
  CGACACTGTGCGCCACCATGGCCGTGACTGCCTGTCAGGGCTTGGGGTTCGTGGTTTCAC
  TGATTGGGATTGCGGGCATCATTGCTGCCACCTGCATGGACCAGTGGAGCACCCAAGACT
  TGTACAACAACCCCGTAACAGCTGTTTTCAACTACCAGGGGCTGTGGCGCTCCTGTGTCC
  GAGAGAGCTCTGGCTTCACCGAGTGCCGGGGCTACTTCACCCTGCTGGGGCTGCCAGCCA
  TGCTGCAGGCAGTGCGAGCCCTGATGATCGTAGGCATCGTCCTGGGTGCCATTGGCCTCC
  TGGTATCCATCTTTGCCCTGAAATGCATCCGCATTGGCAGCATGGAGGACTCTGCCAAAG
  CCAACATGACACTGACCTCCGGGATCATGTTCATTGTCTCAGGTCTTTGTGCAATTGCTG
  GAGTGTCTGTGTTTGCCAACATGCTGGTGACTAACTTCTGGATGTCCACAGCTAACATGT
  ACACCGGCATGGGTGGGATGGTGCAGACTGTTCAGACCAGGTACACATTTGGTGCGGCTC
  TGTTCGTGGGCTGGGTCGCTGGAGGCCTCACACTAATTGGGGGTGTGATGATGTGCATCG
  CCTGCCGGGGCCTGGCACCAGAAGAAACCAACTACAAAGCCGTTTCTTATCATGCCTCAG
  GCCACAGTGTTGCCTACAAGCCTGGAGGCTTCAAGGCCAGCACTGGCTTTGGGTCCAACA
  CCAAAAACAAGAAGATATACGATGGAGGTGCCCGCACAGAGGACGAGGTACAATCTTATC
  CTTCCAAGCACGACTATGTGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001002026
• ORF Size: 786 bp
• Insert Size: 800
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001002026.2, NP_001002026.1
• RefSeq Size: 3350
• RefSeq ORF: 786
• Locus ID: 51208
• Protein Families: Transmembrane
• Protein Pathways: Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is upregulated in patients with ulcerative colitis and highly overexpressed in infiltrating ductal adenocarcinomas. PKC/MAPK/AP-1 (protein kinase C/mitogen-activated protein kinase/activator protein-1) dependent pathway regulates the expression of this gene in gastric cells. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (2) has an alternate 5' exon, as compared to variant 1. It encodes isoform 2, also known as isoform A2, which is of the same size but has a different N-terminus, as compared to isoform 1.