ATP5MC2 (NM_001002031) Human Untagged Clone
CAT#: SC300398
ATP5G2 (untagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2), nuclear gene encoding mitochondrial protein, transcript variant 1
"NM_001002031" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATP5MC2 |
Synonyms | ATP5A; ATP5G2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001002031, the custom clone sequence may differ by one or more nucleotides
ATGCCTGAGCTGATCCTCTCTCCTGCCACAGCTCCTCACCCCCTGAAAATGTTCGCCTGCTCCAAGTTTG TCTCCACTCCCTCCTTGGTCAAGAGCACCTCACAGCTGCTGAGCCGTCCGCTATCTGCAGTGGTGCTGAA ACGACCGGAGATACTGACAGATGAGAGCCTCAGCAGCTTGGCAGTCTCATGTCCCCTTACCTCACTTGTC TCTAGCCGCAGCTTCCAAACCAGCGCCATTTCAAGGGACATCGACACAGCAGCCAAGTTCATTGGAGCTG GGGCTGCCACAGTTGGGGTGGCTGGTTCTGGGGCTGGGATTGGAACTGTGTTTGGGAGCCTCATCATTGG TTATGCCAGGAACCCTTCTCTGAAGCAACAGCTCTTCTCCTACGCCATTCTGGGCTTTGCCCTCTCGGAG GCCATGGGGCTCTTTTGTCTGATGGTAGCCTTTCTCATCCTCTTTGCCATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001002031 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001002031.2, NP_001002031.1 |
RefSeq Size | 1178 bp |
RefSeq ORF | 474 bp |
Locus ID | 517 |
Cytogenetics | 12q13.13 |
Protein Families | Transmembrane |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | 'This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). There are three separate genes which encode subunit c of the proton channel and they specify precursors with different import sequences but identical mature proteins. The protein encoded by this gene is one of three precursors of subunit c. This gene has multiple pseudogenes. [provided by RefSeq, Jan 2018]' Transcript Variant: This variant (1) represents the longer transcript, but encodes the shorter isoform (a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222476 | ATP5G2 (Myc-DDK-tagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 420.00 |
|
RG222476 | ATP5G2 (GFP-tagged) - Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 460.00 |
|
RC222476L1 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC222476L2 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC222476L3 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC222476L4 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review