ATP5MC3 (NM_001002258) Human Untagged Clone

CAT#: SC300423

ATP5G3 (untagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9) (ATP5G3), nuclear gene encoding mitochondrial protein, transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP5MC3
• Synonyms: ATP5G3; P3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001002258, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCGCCTGCGCCAAGCTCGCCTGCACCCCCTCTCTGATCCGAGCTGGATCCAGAGTTGCATACAGAC
  CAATTTCTGCATCAGTGTTATCTCGACCAGAGGCTAGTAGGACTGGAGAGGGCTCTACGGTATTTAATGG
  GGCCCAGAATGGTGTGTCTCAGCTAATCCAAAGGGAGTTTCAGACCAGTGCAATCAGCAGAGACATTGAT
  ACTGCTGCCAAATTTATTGGTGCAGGTGCTGCAACAGTAGGAGTGGCTGGTTCTGGTGCTGGTATTGGAA
  CAGTCTTTGGCAGCCTTATCATTGGTTATGCCAGAAACCCTTCGCTGAAGCAGCAGCTGTTCTCATATGC
  TATCCTGGGATTTGCCTTGTCTGAAGCTATGGGTCTCTTTTGTTTGATGGTTGCTTTCTTGATTTTGTTT
  GCCATGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001002258
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001002258.4, NP_001002258.1
• RefSeq Size: 2741 bp
• RefSeq ORF: 429 bp
• Locus ID: 518
• Cytogenetics: 2q31.1
• Protein Families: Transmembrane
• Protein Pathways: Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
• Gene Summary: 'This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene is one of three genes that encode subunit c of the proton channel. Each of the three genes have distinct mitochondrial import sequences but encode the identical mature protein. Alternatively spliced transcript variants encoding different proteins have been identified. [provided by RefSeq, Jun 2010]'
  Transcript Variant: This variant (3) has multiple differences in the presence and absence of intron sequences at the 5' and 3' ends, compared to variant 4. These differences result in a protein (isoform A) with a longer C-terminus, compared to isoform B. Variants 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.