MARCH8 (NM_001002265) Human Untagged Clone

CAT#: SC300429

41341 (untagged)-Human membrane-associated ring finger (C3HC4) 8 (MARCH8), transcript variant 6


  "NM_001002265" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MARCH8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MARCH8
Synonyms c-MIR; MARCH-VIII; MIR; RNF178
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001002265, the custom clone sequence may differ by one or more nucleotides


ATGAGCATGCCACTGCATCAGATCTCTGCCATTCCATCCCAGGATGCCATCTCTGCTAGAGTCTACAGAA
GTAAGACCAAAGAAAAGGAGAGGGAAGAACAGAATGAGAAGACTTTGGGACATTTCATGAGTCATTCAAG
CAACATTTCTAAGGCTGGGAGTCCTCCGTCAGCATCAGCTCCGGCTCCGGTGTCCTCCTTCTCTCGCACT
TCTATCACGCCATCCAGCCAGGACATCTGCAGGATCTGCCACTGTGAAGGAGATGATGAGAGCCCCCTGA
TCACCCCCTGCCACTGCACAGGAAGCCTCCACTTCGTGCACCAGGCCTGCCTGCAGCAGTGGATCAAGAG
CTCCGACACGCGCTGCTGCGAGCTCTGCAAGTATGAGTTCATCATGGAGACCAAGCTGAAGCCACTGAGA
AAATGGGAGAAGTTGCAGATGACGTCCAGCGAGCGCAGGAAGATCATGTGCTCAGTGACATTCCACGTCA
TTGCCATCACATGTGTGGTCTGGTCCTTGTATGTGCTCATTGACCGTACTGCTGAGGAGATCAAGCAGGG
GCAGGCAACAGGAATCCTAGAATGGCCCTTTTGGACTAAATTGGTGGTTGTGGCCATCGGCTTCACCGGA
GGACTTCTTTTTATGTATGTTCAGTGTAAAGTGTATGTGCAATTGTGGAAGAGACTCAAGGCCTATAATA
GAGTGATCTATGTTCAAAACTGTCCAGAAACAAGCAAAAAGAATATTTTTGAAAAATCTCCACTAACAGA
GCCCAACTTTGAAAATAAACATGGATATGGAATCTGTCATTCCGACACAAACTCTTCTTGTTGCACAGAG
CCTGAAGACACTGGAGCAGAAATCATTCACGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001002265
ORF Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001002265.1, NP_001002265.1
RefSeq Size 2604
RefSeq ORF 876
Locus ID 220972
Protein Families Druggable Genome, Transmembrane
Gene Summary MARCH8 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH8 induces the internalization of several membrane glycoproteins (Goto et al., 2003 [PubMed 12582153]; Bartee et al., 2004 [PubMed 14722266]). [supplied by OMIM, Apr 2010]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.