PRY (PRY2) (NM_001002758) Human Untagged Clone

CAT#: SC300442

PRY2 (untagged)-Human PTPN13-like, Y-linked 2 (PRY2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRY2
• Synonyms: PTPN13LY2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001002758, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAGCCACTGGGCTTGGCTTTCTACTTTCCTGGAGACAAGACAATTTGAATGGCACTGACTGCCAGG
  GATGCAATATTTTATACTTCTCTGAGACTACGGGGAGCATGTGTTCTGAACTTTCCTTGAACAGAGGTCT
  TGAGGCCAGAAGGAAGAAGGATCTTAAAGACTCATTTCTCTGGAGATATGGGAAGGTTGGCTGTATCTCA
  CTTCCACTTCGTGAGATGACCGCCTGGATTAACCCACCCCAAATTTCAGAGATTTTCCAAGGCTACCACC
  AGAGGGTGCACGGAGCTGATGCACTGAGCCTGCAAACCAACTCTCTGAGAAGCAGGTTATCTTCACAGTG
  CCTCGGACAGAGCTTCCTTCTCAGGACACTCGAGAGAGGCCGTGGTTTCAGGGCACTTGGGGACATCTGT
  GGCCACGTTCATGAAGAAGACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001002758
• ORF Size: 444 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001002758.1, NP_001002758.1
• RefSeq Size: 1238
• RefSeq ORF: 444
• Locus ID: 442862
• Protein Families: Phosphatase
• Gene Summary: This gene is located in the nonrecombining portion of the Y chromosome, and expressed specifically in testis. It encodes a protein which has a low degree of similarity to protein tyrosine phosphatase, non-receptor type 13. Two nearly identical copies of this gene exist within a palindromic region. This record represents the more centromeric copy. [provided by RefSeq, Jul 2008]