SMAD1 (NM_001003688) Human Untagged Clone

CAT#: SC300516

SMAD1 (untagged)-Human SMAD family member 1 (SMAD1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SMAD1
• Synonyms: BSP-1; BSP1; JV4-1; JV41; MADH1; MADR1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001003688, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATGTGACAAGTTTATTTTCCTTTACAAGTCCAGCTGTGAAGAGACTTCTTGGGTGGAAACAGGGCG
  ATGAAGAAGAAAAATGGGCAGAGAAAGCTGTTGATGCTTTGGTGAAAAAACTGAAGAAAAAGAAAGGTGC
  CATGGAGGAACTGGAAAAGGCCTTGAGCTGCCCAGGGCAACCGAGTAACTGTGTCACCATTCCCCGCTCT
  CTGGATGGCAGGCTGCAAGTCTCCCACCGGAAGGGACTGCCTCATGTCATTTACTGCCGTGTGTGGCGCT
  GGCCCGATCTTCAGAGCCACCATGAACTAAAACCACTGGAATGCTGTGAGTTTCCTTTTGGTTCCAAGCA
  GAAGGAGGTCTGCATCAATCCCTACCACTATAAGAGAGTAGAAAGCCCTGTACTTCCTCCTGTGCTGGTT
  CCAAGACACAGCGAATATAATCCTCAGCACAGCCTCTTAGCTCAGTTCCGTAACTTAGGACAAAATGAGC
  CTCACATGCCACTCAACGCCACTTTTCCAGATTCTTTCCAGCAACCCAACAGCCACCCGTTTCCTCACTC
  TCCCAATAGCAGTTACCCAAACTCTCCTGGGAGCAGCAGCAGCACCTACCCTCACTCTCCCACCAGCTCA
  GACCCAGGAAGCCCTTTCCAGATGCCAGCTGATACGCCCCCACCTGCTTACCTGCCTCCTGAAGACCCCA
  TGACCCAGGATGGCTCTCAGCCGATGGACACAAACATGATGGCGCCTCCCCTGCCCTCAGAAATCAACAG
  AGGAGATGTTCAGGCGGTTGCTTATGAGGAACCAAAACACTGGTGCTCTATTGTCTACTATGAGCTCAAC
  AATCGTGTGGGTGAAGCGTTCCATGCCTCCTCCACAAGTGTGTTGGTGGATGGTTTCACTGATCCTTCCA
  ACAATAAGAACCGTTTCTGCCTTGGGCTGCTCTCCAATGTTAACCGGAATTCCACTATTGAAAACACCAG
  GCGGCATATTGGAAAAGGAGTTCATCTTTATTATGTTGGAGGGGAGGTGTATGCCGAATGCCTTAGTGAC
  AGTAGCATCTTTGTGCAAAGTCGGAACTGCAACTACCATCATGGATTTCATCCTACTACTGTTTGCAAGA
  TCCCTAGTGGGTGTAGTCTGAAAATTTTTAACAACCAAGAATTTGCTCAGTTATTGGCACAGTCTGTGAA
  CCATGGATTTGAGACAGTCTATGAGCTTACAAAAATGTGTACTATACGTATGAGCTTTGTGAAGGGCTGG
  GGAGCAGAATACCACCGCCAGGATGTTACTAGCACCCCCTGCTGGATTGAGATACATCTGCACGGCCCCC
  TCCAGTGGCTGGATAAAGTTCTTACTCAAATGGGTTCACCTCATAATCCTATTTCATCTGTATCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001003688
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001003688.1, NP_001003688.1
• RefSeq Size: 2880 bp
• RefSeq ORF: 1398 bp
• Locus ID: 4086
• Cytogenetics: 4q31.21
• Protein Families: Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Stem cell relevant signaling - JAK/STAT signaling pathway, Stem cell relevant signaling - TGFb/BMP signaling pathway, Transcription Factors
• Protein Pathways: TGF-beta signaling pathway
• Gene Summary: 'The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 3. All eight variants encode the same protein.