ATP5PF (NM_001003701) Human Untagged Clone
CAT#: SC300525
ATP5J (untagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 5
"NM_001003701" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATP5PF |
Synonyms | ATP5; ATP5A; ATP5J; ATPM; CF6; F6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001003701, the custom clone sequence may differ by one or more nucleotides
ATGCATTGCGATGGCGGAATCAGCATGATTCTTCAGAGGCTCTTCAGGTTCTCCTCTGTC ATTCGGTCAGCCGTCTCAGTCCATTTGCGGAGGAACATTGGTGTTACAGCAGTGGCATTT AATAAGGAACTTGATCCTATACAGAAACTCTTTGTGGACAAGATTAGAGAATACAAATCT AAGCGACAGACATCTGGAGGACCTGTTGATGCTAGTTCAGAGTATCAGCAAGAGCTGGAG AGGGAGCTTTTTAAGCTCAAGCAAATGTTTGGTAATGCAGACATGAATACATTTCCCACC TTCAAATTTGAAGATCCCAAATTTGAAGTCATCGAAAAACCCCAGGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001003701 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001003701.1, NP_001003701.1 |
RefSeq Size | 1217 bp |
RefSeq ORF | 351 bp |
Locus ID | 522 |
Cytogenetics | 21q21.3 |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | 'Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo complex has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the F6 subunit of the Fo complex. The F6 subunit is required for F1 and Fo interactions. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has 1 or more pseudogenes. [provided by RefSeq, Feb 2016]' Transcript Variant: This variant (5) differs in the 5' UTR and the 5' coding region, compared to variant 1. The predicted isoform (b) is longer, and it contains a distinct N-terminus, compared to isoform a. The translation initiation site for this transcript is inferred. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212644 | ATP5J (Myc-DDK-tagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 5 |
USD 420.00 |
|
RG212644 | ATP5J (GFP-tagged) - Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 5 |
USD 460.00 |
|
RC212644L3 | Lenti-ORF clone of ATP5J (Myc-DDK-tagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 5 |
USD 620.00 |
|
RC212644L4 | Lenti-ORF clone of ATP5J (mGFP-tagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 (ATP5J), nuclear gene encoding mitochondrial protein, transcript variant 5 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review