RBMS3 (NM_001003792) Human Untagged Clone

CAT#: SC300546

RBMS3 (untagged)-Human RNA binding motif, single stranded interacting protein 3 (RBMS3), transcript variant 3


  "NM_001003792" in other vectors (4)

Reconstitution Protocol

USD 710.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RBMS3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RBMS3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001003792, the custom clone sequence may differ by one or more nucleotides


ATGGGCAAACGCCTGGATCAGCCACAAATGTACCCCCAGTACACTTACTACTATCCTCATTATCTCCAAA
CCAAGTCCTATGCACCAGCTCCCCACCCCATGGCTCCTCCCAGCCCCAGCACAAACAGCAGCAGCAACAA
CAGCAGCAACAACAGCAGCGGGGAACAGTTGAGTAAAACCAACCTGTACATTCGAGGCCTCCCACCAGGC
ACCACTGACCAGGACCTAATCAAGCTGTGCCAACCGTATGGAAAAATTGTATCTACAAAGGCAATTCTTG
ACAAAAACACAAATCAGTGCAAAGGTTATGGTTTTGTAGATTTTGACAGTCCTGCAGCCGCACAGAAAGC
GGTAGCATCTCTCAAGGCAAATGGCGTGCAGGCACAGATGGCTAAGCAACAAGAGCAAGACCCAACAAAC
CTATACATCTCAAATCTCCCCATTTCTATGGATGAGCAGGAGCTTGAGAATATGCTGAAACCCTTTGGAC
ATGTCATTTCCACAAGAATACTAAGAGACGCTAATGGAGTCAGCAGAGGTGTTGGCTTTGCCAGAATGGA
GTCTACTGAAAAATGTGAAGTGGTAATTCAACATTTTAATGGAAAATATCTGAAAACACCACCAGGCATC
CCAGCCCCCAGTGAGCCTTTGCTGTGCAAATTCGCTGATGGAGGACAAAAGAAGCGACAGAATCAAAGCA
AATATACCCAGAATGGGAGGCCTTGGCCCAGGGAAGGAGAGGCTGGCATGGCTTTGACCTATGACCCCAC
AGCTGCCATACAGAATGGATTTTATTCTTCACCGTACAGTATTGCAACCAACCGCATGATTCCACAGACA
TCTATCACGCCATTCATTGCTGCTTCCCCTGTCTCCACATACCAGGGTGCTGTGATTACACCAACCATGG
ACCATCCCATGTCAATGCAGCCAGCCAACATGATGGGCCCACTGACACAGCAGATGAATCACCTTTCGTT
GGGCACAACAGGAACGATTCAATCCCAAGACAGGATTATGATACTCCACCAGCTGTTGTGTCAGTATATG
ACTGCTGCTGCTCCTATGCAAGGGACCTACATTCCTCAGTACACGCCTGTGCCTCCGACAGCTGTTTCTA
TTGAAGGTGTTGTTGCTGATACCTCTCCCCAGACAGTGGCACCTTCATCCCAGGACACCAGTGGTCAGCA
GCAACAGATAGCAGTGGACACATCCAACGAACATGCACCTGCATATTCTTACCAACAGTCTAAACCATAA


Restriction Sites SgfI-MluI     
ACCN NM_001003792
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001003792.2, NP_001003792.1
RefSeq Size 8180 bp
RefSeq ORF 1260 bp
Locus ID 27303
Cytogenetics 3p24.1
Gene Summary This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Transcript Variant: This variant (3), also known as DD23-S, lacks a 3 nt segment and an in-frame exon in the coding region, as compared to variant 1. The encoded isoform 3 thus lacks an internal aa and an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.