BMF (NM_001003940) Human Untagged Clone

CAT#: SC300580

BMF (untagged)-Human Bcl2 modifying factor (BMF), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BMF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001003940, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGCCATCTCAGTGTGTGGAGGAGCTGGAGGATGATGTGTTCCAACCAGAGGATGGGGAGCCGGTGA
  CCCAACCCGGGAGCTTGCTCTCTGCTGACCTGTTTGCCCAGAGCCTACTGGACTGCCCCCTCAGCCGACT
  TCAGCTCTTCCCTCTCACCCACTGCTGTGGCCCTGGCCTTCGACCCACCAGCCAGGAAGACAAAGCTACC
  CAGACTCTCAGCCCAGCCTCCCCCAGCCAAGGTGTCATGCTGCCTTGTGGGGTGACTGAGGAACCCCAGC
  GACTCTTTTATGGCAATGCTGGCTATCGGCTTCCTCTCCCTGCCAGTTTCCCAGCAGTCTTGCCCATTGG
  GGAGCAGCCCCCCGAAGGGCAGTGGCAACATCAAGCAGAGGTACAGATTGCCCGAAAGCTTCAGTGCATT
  GCAGACCAGTTCCACCGGCTTCATGTGCAGCAACACCAGCAGAACCAAAATCGTGTGTGGTGGCAGATCC
  TCCTCTTCCTGCACAACCTTGCTTTGAATGGAGAAGAGAACAGGAACGGGGCAGGCCCTAGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001003940
• Insert Size: 700 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF. These result in the substitution of 1 aa.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001003940.1, NP_001003940.1
• RefSeq Size: 4700 bp
• RefSeq ORF: 555 bp
• Locus ID: 90427
• Cytogenetics: 15q15.1
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an apoptotic activator. This protein is found to be sequestered to myosin V motors by its association with dynein light chain 2, which may be important for sensing intracellular damage and triggering apoptosis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longest transcript. Transcript variants 1 and 2 encode the longest isoform (bmf-1).