LRRC29 (NM_001004055) Human Untagged Clone

CAT#: SC300591

LRRC29 (untagged)-Human leucine rich repeat containing 29 (LRRC29), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LRRC29
• Synonyms: FBL9; FBXL9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001004055, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACAGCTCTGGGTGGCCTGCAGGAGCTGCAGAGCCTCGACATGGCCGAGGGCGGGAACTGGCCCAGG
  CCCTGGGCTGTATGCACGGGGCTCCATCCCAGCTGGCCTCCCTCAGCCTGGCCCACTGCTCTTCATTGAA
  GTCACGCCCAGAGCTGGAGCATCAGGCCTCAGGTACCAAGGACGCCTGTCCAGAGCCACAGGGCCCCTCC
  CTGCTCACGCTGCGGGCCCTGCAGGAGTTGGACCTCACAGCCTGCAGCAAGCTGACTGATGCCAGTTTAG
  CCAAGGTGCTCCAGTTTCTCCAGCTGAGGCAGCTGTCCCTTAGCCTGTTGCCAGAACTCACAGACAACGG
  CTTGGTTGCTGTGGCCAGGGGCTGTCCTAGCCTGGAGCACTTGGCGCTGAGTCACTGCAGCCGACTCAGT
  GACAAGGGCTGGGCCCAGGCAGCCAGCTCCTGGCCAAGGCTGCAGCATCTCAACCTGTCCAGCTGCAGTC
  AGCTCATAGAGCAGACACTGGATGCTATTGGGCAGGCGTGCAGGCAGCTCCGGGTGTTGGATGTGGCCAC
  GTGCCCTGGCATCAACATGGCCGCCGTCAGACGCTTCCAAGCCCAGCTGCCCCAGGTGTCCTGTGTCCAG
  TCCCGCTTCGTGGGAGGGGCTGACCTGACCCTAACACTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001004055
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001004055.1, NP_001004055.1
• RefSeq Size: 1321 bp
• RefSeq ORF: 672 bp
• Locus ID: 26231
• Cytogenetics: 16q22.1
• Gene Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 9 tandem leucine-rich repeats. Two transcript variants encoding the same protein have been found for this gene. Other variants may occur, but their full-length natures have not been characterized. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.