LIN28B (NM_001004317) Human Untagged Clone
CAT#: SC300636
LIN28B (untagged)-Human lin-28 homolog B (C. elegans) (LIN28B)
"NM_001004317" in other vectors (6)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | LIN28B |
| Synonyms | CSDD2 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001004317 edited
ATGGCCGAAGGCGGGGCTAGCAAAGGTGGTGGAGAAGAGCCCGGGAAGCTGCCGGAGCCG GCAGAGGAGGAATCCCAGGTTTTGCGCGGAACTGGCCACTGTAAGTGGTTCAATGTGCGC ATGGGATTTGGATTCATCTCCATGATAAACCGAGAGGGAAGCCCCTTGGATATTCCAGTC GATGTATTTGTACACCAAAGCAAACTATTCATGGAAGGATTTAGAAGCCTAAAAGAAGGA GAACCAGTGGAATTCACATTTAAAAAATCTTCCAAAGGCCTTGAGTCAATACGGGTAACA GGACCTGGTGGGAGCCCCTGTTTAGGAAGTGAAAGAAGACCCAAAGGGAAGACACTACAG AAAAGAAAACCAAAGGGAGATAGATGCTACAACTGTGGTGGCCTTGATCATCATGCTAAG GAATGTAGTCTACCTCCTCAGCCAAAGAAGTGCCATTACTGTCAGAGCATCATGCACATG GTGGCAAACTGCCCACATAAAAATGTTGCACAGCCACCCGCGAGTTCTCAGGGAAGACAG GAAGCAGAATCCCAGCCATGCACTTCAACTCTCCCTCGAGAAGTGGGAGGCGGGCATGGC TGTACATCACCACCGTTTCCTCAGGAGGCTAGGGCAGAGATCTCAGAACGGTCAGGCAGG TCACCTCAAGAAGCTTCCTCCACGAAGTCATCTATAGCACCAGAAGAGCAAAGCAAAAAG GGGCCTTCAGTTCAAAAAAGGAAAAAGACATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001004317 |
| ORF Size | 753 bp |
| Insert Size | 2900 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001004317.2. |
| Reference Data | |
| RefSeq | NM_001004317.2, NP_001004317.1 |
| RefSeq Size | 5504 |
| RefSeq ORF | 753 |
| Locus ID | 389421 |
| Gene Summary | The protein encoded by this gene belongs to the lin-28 family, which is characterized by the presence of a cold-shock domain and a pair of CCHC zinc finger domains. This gene is highly expressed in testis, fetal liver, placenta, and in primary human tumors and cancer cell lines. It is negatively regulated by microRNAs that target sites in the 3' UTR, and overexpression of this gene in primary tumors is linked to the repression of let-7 family of microRNAs and derepression of let-7 targets, which facilitates cellular transformation. [provided by RefSeq, Jun 2012] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213537 | LIN28B (Myc-DDK-tagged)-Human lin-28 homolog B (C. elegans) (LIN28B) |
USD 450.00 |
|
| RG213537 | LIN28B (GFP-tagged) - Human lin-28 homolog B (C. elegans) (LIN28B) |
USD 460.00 |
|
| RC213537L1 | Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), Myc-DDK-tagged |
USD 768.00 |
|
| RC213537L2 | Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), mGFP tagged |
USD 620.00 |
|
| RC213537L3 | Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), Myc-DDK-tagged |
USD 620.00 |
|
| RC213537L4 | Lenti ORF clone of Human lin-28 homolog B (C. elegans) (LIN28B), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China