OR4C16 (NM_001004701) Human Untagged Clone

CAT#: SC300744

OR4C16 (untagged)-Human olfactory receptor, family 4, subfamily C, member 16 (OR4C16)


  "NM_001004701" in other vectors (4)

Reconstitution Protocol

USD 660.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "OR4C16"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol OR4C16
Synonyms OR11-135
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001004701, the custom clone sequence may differ by one or more nucleotides


ATGCAACTGAATAATAATGTGACTGAGTTCATTCTGCTTGGATTGACACAGGATCCTTTTTGGAAGAAAA
TAGTGTTTGTTATTTTTTTGCGTCTCTACTTGGGAACACTGTTGGGTAATTTGCTAATCATTATTAGTGT
CAAGACCAGCCAGGCACTTAAGAACCCAATGTTCTTCTTCCTTTTCTACTTATCCTTATCTGATACTTGC
CTCTCTACTTCCATAACCCCTAGAATGATTGTGGATGCCCTTTTGAAGAAGACAACTATCTCCTTCAGCG
AGTGCATGATCCAAGTCTTTTCATCCCATGTCTTTGGCTGCCTGGAGATCTTCATCCTCATCCTCACGGC
TGTTGACCGCTATGTGGACATCTGTAAGCCCCTGCACTACATGACCATCATAAGCCAGTGGGTCTGTGGT
GTTTTGATGGCTGTGGCCTGGGTGGGATCCTGTGTGCATTCTTTAGTTCAGATTTTTCTTGCCCTGAGTT
TGCCATTCTGTGGCCCCAATGTGATCAATCACTGTTTCTGTGACTTGCAGCCCTTGTTGAAACAAGCCTG
TTCAGAAACCTATGTGGTTAACCTACTCCTGGTTTCCAATAGTGGGGCCATTTGTGCAGTGAGTTATGTC
ATGCTAATATTCTCCTATGTCATCTTCTTGCATTCTCTGAGAAACCACAGTGCTGAAGTGATAAAGAAAG
CACTTTCCACATGTGTCTCCCACATCATTGTGGTCATCTTGTTCTTTGGACCTTGCATATTTATGTACAC
ATGCCTTGCAACCGTATTCCCCATGGATAAGATGATAGCTGTATTTTATACAGTTGGAACATCTTTTCTC
AACCCTGTGATTTACACGCTGAAGAATACAGAAGTGAAAAGTGCCATGAGGAAGCTTTGGAGCAAGAAAT
TGATCACAGATGACAAAAGATAA


Restriction Sites SgfI-MluI     
ACCN NM_001004701
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001004701.2, NP_001004701.2
RefSeq Size 933 bp
RefSeq ORF 933 bp
Locus ID 219428
Cytogenetics 11q11
Protein Families Transmembrane
Protein Pathways Olfactory transduction
Gene Summary Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. This olfactory receptor gene is a segregating pseudogene, where some individuals have an allele that encodes a functional olfactory receptor, while other individuals have an allele encoding a protein that is predicted to be non-functional. [provided by RefSeq, Jun 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.