Nck beta (NCK2) (NM_001004722) Human Untagged Clone

CAT#: SC300760

NCK2 (untagged)-Human NCK adaptor protein 2 (NCK2), transcript variant 3


  "NM_001004722" in other vectors (4)

Reconstitution Protocol

USD 420.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "NCK2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NCK2
Synonyms GRB4; NCKbeta
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001004722, the custom clone sequence may differ by one or more nucleotides
ATGACAGAAGAAGTTATTGTGATAGCCAAGTGGGACTACACCGCCCAGCAGGACCAGGAG
CTGGACATCAAGAAGAACGAGCGGCTGTGGTTGCTGGACGACTCCAAGACGTGGTGGCGG
GTGAGGAACGCGGCCAACAGGACGGGCTATGTACCGTCCAACTACGTGGAGCGGAAGAAC
AGCCTGAAGAAGGGCTCCCTCGTGAAGAACCTGAAGGACACACTAGCCCAGCGACTTCTC
CGTGTCCCTTAA
Restriction Sites Please inquire     
ACCN NM_001004722
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001004722.1, NP_001004722.1
RefSeq Size 1976 bp
RefSeq ORF 252 bp
Locus ID 8440
Cytogenetics 2q12.2
Protein Families Druggable Genome
Protein Pathways Axon guidance, ErbB signaling pathway, Pathogenic Escherichia coli infection, T cell receptor signaling pathway
Gene Summary This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks an exon, which results in a frameshift, compared to variant 1. The resulting protein (isoform B) is shorter and has a distinct C-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.