OR56B4 (NM_001005181) Human Untagged Clone
CAT#: SC300821
OR56B4 (untagged)-Human olfactory receptor, family 56, subfamily B, member 4 (OR56B4)
"NM_001005181" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | OR56B4 |
Synonyms | OR11-67 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001005181, the custom clone sequence may differ by one or more nucleotides
ATGGATACCTCCACCAGTGTTACCTATGACTCCAGCCTCCAGATTTCCCAGTTCATCCTGATGGGATTAC CAGGCATTCATGAGTGGCAGCACTGGCTCTCCCTGCCCCTGACTCTGCTCTACCTCTTAGCTCTTGGTGC CAATCTCCTCATCATAATCACCATTCAACATGAGACCGTGCTACATGAACCCATGTACCATTTGCTGGGC ATATTAGCAGTGGTGGACATTGGCCTGGCCACCACCATCATGCCCAAGATCCTGGCCATCTTCTGGTTTG ATGCCAAGGCCATTAGCCTCCCCATGTGTTTTGCTCAGATCTATGCCATCCACTGCTTCTTCTGCATAGA GTCAGGCATCTTTCTCTGCATGGCAGTAGACAGATACATAGCCATCTGTCGCCCTCTTCAGTACCCCTCC ATAGTCACTAAAGCTTTTGTCTTCAAAGCCACAGGGTTCATCATGCTCAGGAATGGCCTGTTGACCATCC CAGTGCCTATACTGGCTGCCCAGAGACACTACTGTTCCAGGAATGAAATCGAGCACTGCCTCTGCTCTAA CTTGGGGGTTATCAGCCTGGCTTGTGATGACATCACTGTGAACAAATTTTACCAACTGATGCTAGCATGG GTCTTGGTTGGGAGTGATATGGCTCTGGTATTTTCTTCCTATGCTGTAATCCTTCACTCTGTGCTGAGGC TGAACTCAGCAGAAGCAATGTCCAAGGCTCTGAGCACTTGTAGCTCCCACCTCATCCTCATCCTCTTCCA CACAGGTATCATTGTGCTGTCTGTCACACACCTTGCAGAGAAAAAGATTCCCCTTATTCCTGTGTTCCTT AATGTGCTGCACAATGTCATCCCCCCTGCACTCAACCCCCTGGCCTGTGCACTCAGGATGCACAAACTCA GACTGGGCTTTCAGAGACTGCTTGGACTGGGTCAGGACGTGTCCAAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001005181 |
ORF Size | 960 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001005181.2, NP_001005181.1 |
RefSeq Size | 1152 |
RefSeq ORF | 960 |
Locus ID | 196335 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Olfactory transduction |
Gene Summary | Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222298 | OR56B4 (Myc-DDK-tagged)-Human olfactory receptor, family 56, subfamily B, member 4 (OR56B4) |
USD 420.00 |
|
RG222298 | OR56B4 (GFP-tagged) - Human olfactory receptor, family 56, subfamily B, member 4 (OR56B4) |
USD 460.00 |
|
RC222298L3 | Lenti ORF clone of Human olfactory receptor, family 56, subfamily B, member 4 (OR56B4), Myc-DDK-tagged |
USD 620.00 |
|
RC222298L4 | Lenti ORF clone of Human olfactory receptor, family 56, subfamily B, member 4 (OR56B4), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review