AK3L1 (AK4) (NM_001005353) Human Untagged Clone

CAT#: SC300914

AK4 (untagged)-Human adenylate kinase 4 (AK4), nuclear gene encoding mitochondrial protein, transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AK4
• Synonyms: AK3; AK3L1; AK3L2; AK 4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001005353, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTTCCAAACTCCTGCGCGCGGTCATCCTCGGGCCGCCCGGCTCGGGCAAGGGCACCGTGTGCCAGA
  GGATCGCCCAGAACTTTGGTCTCCAGCATCTCTCCAGCGGCCACTTCTTGCGGGAGAACATCAAGGCCAG
  CACCGAAGTTGGTGAGATGGCAAAGCAGTATATAGAGAAAAGTCTTTTGGTTCCAGACCATGTGATCACA
  CGCCTAATGATGTCCGAGTTGGAGAACAGGCGTGGCCAGCACTGGCTCCTTGATGGTTTTCCTAGGACAT
  TAGGACAAGCCGAAGCCCTGGACAAAATCTGTGAAGTGGATCTAGTGATCAGTTTGAATATTCCATTTGA
  AACACTTAAAGATCGTCTCAGCCGCCGTTGGATTCACCCTCCTAGCGGAAGGGTATATAACCTGGACTTC
  AATCCACCTCATGTACATGGTATTGATGACGTCACTGGTGAACCGTTAGTCCAGCAGGAGGATGATAAAC
  CCGAAGCAGTTGCTGCCAGGCTAAGACAGTACAAAGACGTGGCAAAGCCAGTCATTGAATTATACAAGAG
  CCGAGGAGTGCTCCACCAATTTTCCGGAACGGAGACGAACAAAATCTGGCCCTACGTTTACACACTTTTC
  TCAAACAAGATCACACCTATTCAGTCCAAAGAAGCATATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001005353
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001005353.2, NP_001005353.1
• RefSeq Size: 6998 bp
• RefSeq ORF: 672 bp
• Locus ID: 205
• Cytogenetics: 1p31.3
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Purine metabolism
• Gene Summary: 'This gene encodes a member of the adenylate kinase family of enzymes. The encoded protein is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. A pseudogene for this gene has been located on chromosome 17. Three transcript variants encoding the same protein have been identified for this gene. Sequence alignment suggests that the gene defined by NM_013410, NM_203464, and NM_001005353 is located on chromosome 1. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1, 2, and 3 all encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.