PLAUR (NM_001005377) Human Untagged Clone

CAT#: SC300934

PLAUR (untagged)-Human plasminogen activator, urokinase receptor (PLAUR), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PLAUR
• Synonyms: CD87; U-PAR; UPAR; URKR
• Vector: pCMV6-AC
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_001005377 edited
  CCTTCCTGAGGCCAGAAGGAGAGAAGACGTGCAGGGACCCCGCGCACAGGAGCTGCCCTC
  GCGACATGGGTCACCCGCCGCTGCTGCCGCTGCTGCTGCTGCTCCACACCTGCGTCCCAG
  CCTCTTGGGGCCTGCGGTGCATGCAGTGTAAGACCAACGGGGATTGCCGTGTGGAAGAGT
  GCGCCCTGGGACAGGACCTCTGCAGGACCACGATCGTGCGCTTGTGGGAAGAAGGAGAAG
  AGCTGGAGCTGGTGGAGAAAAGCTGTACCCACTCAGAGAAGACCAACAGGACCCTGAGCT
  ATCGGACTGGCTTGAAGATCACCAGCCTTACCGAGGTTGTGTGTGGGTTAGACTTGTGCA
  ACCAGGGCAACTCTGGCCGGGCTGTCACCTATTCCCGAAGCCGTTACCTCGAATGCATTT
  CCTGTGGCTCATCAGACATGAGCTGTGAGAGGGGCCGGCACCAGAGCCTGCAGTGCCGCA
  GCCCTGAAGAACAGTGCCTGGATGTGGTGACCCACTGGATCCAGGAAGGTGAAGAAGTCC
  TGGAGCTTGAAAATCTGCCGCAGAATGGCCGCCAGTGTTACAGCTGCAAGGGGAACAGCA
  CCCATGGATGCTCCTCTGAAGAGACTTTCCTCATTGACTGCCGAGGCCCCATGAATCAAT
  GTCTGGTAGCCACCGGCACTCACGAACCGAAAAACCAAAGCTATATGGTAAGAGGCTGTG
  CAACCGCCTCAATGTGCCAACATGCCCACCTGGGTGACGCCTTCAGCATGAACCACATTG
  ATGTCTCCTGCTGTACTAAAAGTGGCTGTAACCACCCAGACCTGGATGTCCAGTACCGCA
  GTGGGGCTGCTCCTCAGCCTGGCCCTGCCCATCTCAGCCTCACCATCACCCTGCTAATGA
  CTGCCAGACTGTGGGGAGGCACTCTCCTCTGGACCTAAACCTGAAATCCCCCTCTCTGCC
  CTGGCTGGATCCGGGGGACCCCTTTGCCCTTCCCTCGGCTCCCAGCCCTACAGACTTGCT
  GTGTGACCTCAGGCCAGTGTGCCGACCTCTCTGGGCCTCAGTTTTCCCAGCTATGAAAAC
  AGCTATCTCACAAAGTTGTGTGAAGCAGAAGAGAAAAGCTGGAGGAAGGCCGTGGGCCAA
  TGGGAGAGCTCTTGTTATTATTAATATTGTTGCCGCTGTTGTGTTGTTGTTATTAATTAA
  AAAAAAAAAAAAAAAAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001005377
• Insert Size: 1200 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001005377.1, NP_001005377.1
• RefSeq Size: 1413 bp
• RefSeq ORF: 873 bp
• Locus ID: 5329
• Cytogenetics: 19q13.31
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Complement and coagulation cascades
• Gene Summary: 'This gene encodes the receptor for urokinase plasminogen activator and, given its role in localizing and promoting plasmin formation, likely influences many normal and pathological processes related to cell-surface plasminogen activation and localized degradation of the extracellular matrix. It binds both the proprotein and mature forms of urokinase plasminogen activator and permits the activation of the receptor-bound pro-enzyme by plasmin. The protein lacks transmembrane or cytoplasmic domains and may be anchored to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) moiety following cleavage of the nascent polypeptide near its carboxy-terminus. However, a soluble protein is also produced in some cell types. Alternative splicing results in multiple transcript variants encoding different isoforms. The proprotein experiences several post-translational cleavage reactions that have not yet been fully defined. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (3) lacks one exon in the coding region and encodes an isoleucine rather than a valine following the splice site, compared to variant 1. Variant 3 encodes isoform 3 which is longer and lacks one of three LU (Ly-6 antigen/uPA receptor-like) domains, compared to isoform 2.