YPEL2 (NM_001005404) Human Untagged Clone

CAT#: SC300939

YPEL2 (untagged)-Human yippee-like 2 (Drosophila) (YPEL2)


  "NM_001005404" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "YPEL2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol YPEL2
Synonyms FKSG4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001005404, the custom clone sequence may differ by one or more nucleotides


ATGGTGAAGATGACAAGATCGAAGACTTTCCAGGCATATCTGCCCTCCTGCCACCGGACCTACAGCTGCA
TTCACTGCAGAGCTCACTTGGCCAATCATGATGAACTAATTTCCAAGTCATTCCAAGGAAGTCAAGGACG
AGCATACCTCTTTAACTCAGTAGTTAATGTGGGCTGTGGGCCTGCAGAAGAGCGAGTGTTGCTAACAGGA
CTGCATGCAGTCGCAGACATTTACTGTGAAAACTGCAAAACCACTCTGGGCTGGAAATACGAACATGCTT
TTGAAAGCAGCCAGAAATATAAAGAAGGCAAATACATCATTGAACTAGCACACATGATCAAGGACAATGG
CTGGGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001005404
ORF Size 360 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001005404.3, NP_001005404.1
RefSeq Size 5242
RefSeq ORF 360
Locus ID 388403

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.