ZWINT (NM_001005413) Human Untagged Clone

CAT#: SC300947

ZWINT (untagged)-Human ZW10 interactor (ZWINT), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZWINT
• Synonyms: HZwint-1; KNTC2AP; SIP30; ZWINT1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001005413, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGCAGCGGAGACAGAGGCGGAAGCTGCAGCCCTAGAGGTCCTGGCTGAGGTGGCAGGCATCTTGG
  AACCTGTAGGCCTGCAGGAGGAGGCAGAACTGCCAGCCAAGATCCTGGTTGAGTTTGTGGTGGACTCTCA
  GAAGAAAGACAAGCTGCTCTGCAGCCAGCTTCAGGTAGCGGATTTCCTGCAGAACATCCTGGCTCAGGAG
  GACACTGCTAAGGGTCTCGACCCCTTGGCTTCTGAAGACACGAGCCGACAGAAGGCAATTGCAGCTAAGG
  AACAATGGAAAGAGCTGAAGGCCACCTACAGGGAGCACGTAGAGGCCATCAAAATTGGCCTCACCAAGGC
  CCTGACTCAGATGGAGGAAGCCCAGAGGAAACGGACACAACTCCGGGAAGCCTTTGAGCAGCTCCAGGCC
  AAGAAACAAATGGCCATGGAGAAACGCAGAGCAGTCCAGAACCAGTGGCAGCTACAACAGGAGAAGCATC
  TGCAGCATCTGGCGGAGGTTTCTGCAGAGGGTAAGCTGTTGTTCCCTGAGGCTGAGGCTGAGGCAGAGAA
  TCTTCCAGATGATAAACCCCAGCAGCCGACTCGACCCCAGGAGCAGAGTACAGGAGACACCATGGGGAGA
  GACCCTGGTGTGTCCTTCAAGGCTGTTGGTCTACAACCTGCTGGAGATGTAAATTTGCCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001005413
• ORF Size: 693 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001005413.1, NP_001005413.1
• RefSeq Size: 1546
• RefSeq ORF: 693
• Locus ID: 11130
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein that is clearly involved in kinetochore function although an exact role is not known. It interacts with ZW10, another kinetochore protein, possibly regulating the association between ZW10 and kinetochores. The encoded protein localizes to prophase kinetochores before ZW10 does and it remains detectable on the kinetochore until late anaphase. It has a uniform distribution in the cytoplasm of interphase cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.