OR10AG1 (NM_001005491) Human Untagged Clone

CAT#: SC300974

OR10AG1 (untagged)-Human olfactory receptor, family 10, subfamily AG, member 1 (OR10AG1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OR10AG1
• Synonyms: OR11-160
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001005491, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAATTTGTTCTTTTGGGGTTTTCTGATATTCCCAATCTCCACTGGATGCTTTTTAGTATATTTTTAC
  TTATGTATTTGATGATCCTGATGTGCAATGGCATCATAATACTACTAATAAAAATTCACCCCGCTCTCCA
  GACTCCCATGTATTTTTTTCTTAGCAATTTTTCCCTTTTGGAAATCTGTTATGTAACAATCATTATCCCA
  AGAATGCTCATGGACATTTGGACTCAGAAAGGAAATATTTCTTTGTTTGCTTGTGCTACACAAATGTGTT
  TTTTTCTTATGCTTGGAGGCACGGAGTGTCTCCTTCTGACAGTGATGGCCTATGACCGCTACGTGGCTAT
  TTGTAAGCCTTTGCAGTATCCTCTAGTGATGAACCACAAAGTCTGCATTCAGCTGATAATAGCTTCCTGG
  ACCATCACAATTCCTGTAGTAATTGGGGAAACATGCCAAATTTTCCTTTTGCCCTTTTGCGGAACTAACA
  CAATTAATCATTTCTTTTGTGACATCCCGCCAATACTCAAGCTTGCTTGTGGAAACATATTTGTGAATGA
  GATAACAGTCCATGTAGTAGCGGTGGTGTTTATCACGGTGCCATTTCTGTTGATTGTTGTCTCTTATGGC
  AAAATTATCTCCAACATTTTGAAATTGTCATCAGCCAGAGGAAAGGCTAAAGCCTTCTCCACCTGCTCAT
  CTCACCTAATAGTTGTAATCTTATTCTTTGGAGCAGGTACTATCACTTATTTACAGCCCAAACCACATCA
  GTTTCAAAGGATGGGGAAACTGATTTCTCTTTTCTACACCATTCTGATTCCAACTTTGAATCCTATTATA
  TATACCCTGAGGAACAAAGATATCATGGTGGCATTGAGAAAATTACTAGCTAAGTTATTAACATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001005491
• ORF Size: 906 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001005491.1, NP_001005491.1
• RefSeq Size: 906
• RefSeq ORF: 906
• Locus ID: 282770
• Protein Families: Transmembrane
• Protein Pathways: Olfactory transduction
• Gene Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]