GBA (NM_001005742) Human Untagged Clone

CAT#: SC301021

GBA (untagged)-Human glucosidase, beta, acid (GBA), transcript variant 3


  "NM_001005742" in other vectors (6)

Reconstitution Protocol

USD 760.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GBA
Synonyms GBA1; GCB; GLUC
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001005742, the custom clone sequence may differ by one or more nucleotides


ATGGAGTTTTCAAGTCCTTCCAGAGAGGAATGTCCCAAGCCTTTGAGTAGGGTAAGCATCATGGCTGGCA
GCCTCACAGGATTGCTTCTACTTCAGGCAGTGTCGTGGGCATCAGGTGCCCGCCCCTGCATCCCTAAAAG
CTTCGGCTACAGCTCGGTGGTGTGTGTCTGCAATGCCACATACTGTGACTCCTTTGACCCCCCGACCTTT
CCTGCCCTTGGTACCTTCAGCCGCTATGAGAGTACACGCAGTGGGCGACGGATGGAGCTGAGTATGGGGC
CCATCCAGGCTAATCACACGGGCACAGGCCTGCTACTGACCCTGCAGCCAGAACAGAAGTTCCAGAAAGT
GAAGGGATTTGGAGGGGCCATGACAGATGCTGCTGCTCTCAACATCCTTGCCCTGTCACCCCCTGCCCAA
AATTTGCTACTTAAATCGTACTTCTCTGAAGAAGGAATCGGATATAACATCATCCGGGTACCCATGGCCA
GCTGTGACTTCTCCATCCGCACCTACACCTATGCAGACACCCCTGATGATTTCCAGTTGCACAACTTCAG
CCTCCCAGAGGAAGATACCAAGCTCAAGATACCCCTGATTCACCGAGCCCTGCAGTTGGCCCAGCGTCCC
GTTTCACTCCTTGCCAGCCCCTGGACATCACCCACTTGGCTCAAGACCAATGGAGCGGTGAATGGGAAGG
GGTCACTCAAGGGACAGCCCGGAGACATCTACCACCAGACCTGGGCCAGATACTTTGTGAAGTTCCTGGA
TGCCTATGCTGAGCACAAGTTACAGTTCTGGGCAGTGACAGCTGAAAATGAGCCTTCTGCTGGGCTGTTG
AGTGGATACCCCTTCCAGTGCCTGGGCTTCACCCCTGAACATCAGCGAGACTTCATTGCCCGTGACCTAG
GTCCTACCCTCGCCAACAGTACTCACCACAATGTCCGCCTACTCATGCTGGATGACCAACGCTTGCTGCT
GCCCCACTGGGCAAAGGTGGTACTGACAGACCCAGAAGCAGCTAAATATGTTCATGGCATTGCTGTACAT
TGGTACCTGGACTTTCTGGCTCCAGCCAAAGCCACCCTAGGGGAGACACACCGCCTGTTCCCCAACACCA
TGCTCTTTGCCTCAGAGGCCTGTGTGGGCTCCAAGTTCTGGGAGCAGAGTGTGCGGCTAGGCTCCTGGGA
TCGAGGGATGCAGTACAGCCACAGCATCATCACGAACCTCCTGTACCATGTGGTCGGCTGGACCGACTGG
AACCTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCCCATCATTGTAG
ACATCACCAAGGACACGTTTTACAAACAGCCCATGTTCTACCACCTTGGCCACTTCAGCAAGTTCATTCC
TGAGGGCTCCCAGAGAGTGGGGCTGGTTGCCAGTCAGAAGAACGACCTGGACGCAGTGGCACTGATGCAT
CCCGATGGCTCTGCTGTTGTGGTCGTGCTAAACCGCTCCTCTAAGGATGTGCCTCTTACCATCAAGGATC
CTGCTGTGGGCTTCCTGGAGACAATCTCACCTGGCTACTCCATTCACACCTACCTGTGGCGTCGCCAGTG
A


Restriction Sites SgfI-MluI     
ACCN NM_001005742
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001005742.2, NP_001005742.1
RefSeq Size 2564 bp
RefSeq ORF 1611 bp
Locus ID 2629
Cytogenetics 1q22
Protein Families Druggable Genome
Protein Pathways Lysosome, Metabolic pathways, Other glycan degradation, Sphingolipid metabolism
Gene Summary 'This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]'
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.