VPS24 (CHMP3) (NM_001005753) Human Untagged Clone

CAT#: SC301031

CHMP3 (untagged)-Human vacuolar protein sorting 24 homolog (S. cerevisiae) (VPS24), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHMP3
• Synonyms: CGI-149; NEDF; VPS24
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001005753, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCAGGTCAAGGAAGGCTGTGAGCAAGCTGTATGCATCCAAAGCACACATGAACTCAGTGCTCATGG
  GGATGAAGAACCAGCTCGCGGTCTTGCGAGTGGCTGGTTCCCTGCAGAAGAGCACAGAAGTGATGAAGGC
  CATGCAAAGTCTTGTGAAGATTCCAGAGATTCAGGCCACCATGAGGGAGTTGTCCAAAGAAATGATGAAG
  GCTGGGATCATAGAGGAGATGTTAGAGGACACTTTTGAAAGCATGGACGATCAGGAAGAAATGGAGGAAG
  AAGCAGAAATGGAAATTGACAGAATTCTCTTTGAAATTACAGCAGGGGCCTTGGGCAAAGCACCCAGTAA
  AGTGACTGATGCCCTTCCAGAGCCAGAACCTCCAGGAGCGATGGCTGCCTCAGAGGATGAGGAGGAGGAG
  GAAGAGGCTCTGGAGGCCATGCAGTCCCGGCTGGCCACACTCCGCAGCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001005753
• ORF Size: 471 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001005753.2, NP_001005753.1
• RefSeq Size: 3133
• RefSeq ORF: 471
• Locus ID: 51652
• Protein Pathways: Endocytosis
• Gene Summary: This gene encodes a protein that sorts transmembrane proteins into lysosomes/vacuoles via the multivesicular body (MVB) pathway. This protein, along with other soluble coiled-coil containing proteins, forms part of the ESCRT-III protein complex that binds to the endosomal membrane and recruits additional cofactors for protein sorting into the MVB. This protein may also co-immunoprecipitate with a member of the IFG-binding protein superfamily. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ring finger protein 103 (RNF103) gene. [provided by RefSeq, Nov 2010]
  Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region, compared to variant 1. This results in translation initiation from a downstream start codon and an isoform (2, also known as Vps24beta) that has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.