SIN1 (MAPKAP1) (NM_001006618) Human Untagged Clone

CAT#: SC301079

MAPKAP1 (untagged)-Human mitogen-activated protein kinase associated protein 1 (MAPKAP1), transcript variant 6


  "NM_001006618" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAPKAP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAPKAP1
Synonyms JC310; MIP1; SIN1; SIN1b; SIN1g
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001006618, the custom clone sequence may differ by one or more nucleotides


ATGGCCTTCTTGGACAATCCAACTATCATTCTAGCTCATATTCGACAGTCACATGTGACCAGTGATGACA
CGGGAATGTGTGAGATGGTTCTCATTGATCATGATGTTGACCTAGAGAAGATTCATCCTCCTTCAATGCC
TGGAGACAGTGGGTCAGAAATTCAGGGAAGCAATGGTGAGACTCAGGGCTATGTATATGCCCAGTCAGTC
GATATTACCTCAAGTTGGGACTTTGGTATTAGAAGACGCTCAAACACAGCTCAAAGATTAGAACGACTCC
GAAAAGAGAGACAAAACCAGATCAAATGCAAAAATATTCAGTGGAAAGAAAGAAATTCTAAGCAATCAGC
CCAGGAGTTAAAGTCACTGTTTGAAAAAAAATCTCTCAAAGAGAAGCCTCCAATTTCTGGGAAGCAGTCG
ATATTATCTGTACGCCTAGAACAGTGCCCTCTGCAGCTGAATAACCCTTTTAACGAGTATTCCAAATTTG
ATGGCAAGGGTCATGTAGGTACAACAGCAACCAAGAAGATCGATGTCTACCTCCCTCTGCACTCGAGCCA
GGACAGACTGCTGCCAATGACCGTGGTGACAATGGCCAGCGCCAGGGTGCAGGACCTGATCGGGCTCATC
TGCTGGCAGTATACAAGCGAAGGACGGGAGCCGAAGCTCAATGACAATGTCAGTGCCTACTGCCTGCATA
TTGCTGAGGATGATGGGGAGGTGGACACCGATTTCCCCCCGCTGGATTCCAATGAGCCCATTCATAAGTT
TGGCTTCAGTACTTTGGCCCTGGTTGAAAAGTACTCATCTCCTGGTCTGACATCCAAAGAGTCACTCTTT
GTTCGAATAAATGCTGCTCATGGATTCTCCCTTATTCAGGTGGACAACACAAAGGTTACCATGAAGGAAA
TCTTACTGAAGGCAGTGAAGCGAAGAAAAGGATCCCAGAAAGTTTCAGGTGCTTGTGACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001006618
ORF Size 972 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001006618.1, NP_001006619.1
RefSeq Size 1593
RefSeq ORF 972
Locus ID 79109
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that is highly similar to the yeast SIN1 protein, a stress-activated protein kinase. Alternatively spliced transcript variants encoding distinct isoforms have been described. Alternate polyadenylation sites as well as alternate 3' UTRs have been identified for transcripts of this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6), also known as Sin1a, differs in the 3' coding region and UTR, compared to variant 1. The resulting protein (isoform 5), also known as the alpha isoform, has a shorter and distinct C-terminus, compared to isoform 1. The existence of this isoform has not been confirmed experimentally.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.