SIN1 (MAPKAP1) (NM_001006619) Human Untagged Clone

CAT#: SC301080

MAPKAP1 (untagged)-Human mitogen-activated protein kinase associated protein 1 (MAPKAP1), transcript variant 3


  "NM_001006619" in other vectors (4)

Reconstitution Protocol

USD 790.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAPKAP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAPKAP1
Synonyms JC310; MIP1; SIN1; SIN1b; SIN1g
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001006619, the custom clone sequence may differ by one or more nucleotides


ATGGCCTTCTTGGACAATCCAACTATCATTCTAGCTCATATTCGACAGTCACATGTGACCAGTGATGACA
CGGGAATGTGTGAGATGGTTCTCATTGATCATGATGTTGACCTAGAGAAGATTCATCCTCCTTCAATGCC
TGGAGACAGTGGGTCAGAAATTCAGGGAAGCAATGGTGAGACTCAGGGCTATGTATATGCCCAGTCAGTC
GATATTACCTCAAGTTGGGACTTTGGTATTAGAAGACGCTCAAACACAGCTCAAAGATTAGAACGACTCC
GAAAAGAGAGACAAAACCAGATCAAATGCAAAAATATTCAGTGGAAAGAAAGAAATTCTAAGCAATCAGC
CCAGGAGTTAAAGTCACTGTTTGAAAAAAAATCTCTCAAAGAGAAGCCTCCAATTTCTGGGAAGCAGTCG
ATATTATCTGTACGCCTAGAACAGTGCCCTCTGCAGCTGAATAACCCTTTTAACGAGTATTCCAAATTTG
ATGGCAAGGGTCATGTAGGTACAACAGCAACCAAGAAGATCGATGTCTACCTCCCTCTGCACTCGAGCCA
GGACAGACTGCTGCCAATGACCGTGGTGACAATGGCCAGCGCCAGGGTGCAGGACCTGATCGGGCTCATC
TGCTGGCAGTATACAAGCGAAGGACGGGAGCCGAAGCTCAATGACAATGTCAGTGCCTACTGCCTGCATA
TTGCTGAGGATGATGGGGAGGTGGACACCGATTTCCCCCCGCTGGATTCCAATGAGCCCATTCATAAGTT
TGGCTTCAGTACTTTGGCCCTGGTTGAAAAGTACTCATCTCCTGGTCTGACATCCAAAGAGTCACTCTTT
GTTCGAATAAATGCTGCTCATGGATTCTCCCTTATTCAGGTGGACAACACAAAGGTTACCATGAAGGAAA
TCTTACTGAAGGCAGTGAAGCGAAGAAAAGGATCCCAGAAAGTTTCAGGCCCTCAGTACCGCCTGGAGAA
GCAGAGCGAGCCCAATGTCGCCGTTGACCTGGACAGCACTTTGGAGAGCCAGAGCGCATGGGAGTTCTGC
CTGGTCCGCGAGAACAGTATCTCTGGAGACAAAGTAGAGATAGACCCTGTTACGAATCAGAAAGCCAGCA
CTAAGTTTTGGATTAAGCAGAAACCCATCTCAATCGATTCCGACCTGCTCTGTGCCTGTGACCTTGCTGA
AGAGAAAAGCCCCAGTCACGCAATATTTAAACTCACGTATCTAAGCAATCACGACTATAAACACCTCTAC
TTTGAATCGGACGCTGCTACCGTCAATGAAATTGTGCTCAAGGTTAACTACATCCTGGAATCGCGAGCTA
GCACTGCCCGGGCTGACTACTTTGCTCAAAAACAAAGAAAACTGAACAGACGTACGAGCTTCAGCTTCCA
GAAGGAGAAGAAATCCGGGCAGCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001006619
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001006619.1, NP_001006620.1
RefSeq Size 3254 bp
RefSeq ORF 1428 bp
Locus ID 79109
Cytogenetics 9q33.3
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that is highly similar to the yeast SIN1 protein, a stress-activated protein kinase. Alternatively spliced transcript variants encoding distinct isoforms have been described. Alternate polyadenylation sites as well as alternate 3' UTRs have been identified for transcripts of this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3), also known as Sin1g, lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting protein (isoform 3), also known as the gamma isoform, is shorter, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.