SIN1 (MAPKAP1) (NM_001006621) Human Untagged Clone

CAT#: SC301082

MAPKAP1 (untagged)-Human mitogen-activated protein kinase associated protein 1 (MAPKAP1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAPKAP1
• Synonyms: JC310; MIP1; SIN1; SIN1b; SIN1g
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001006621, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACCGTGGTGACAATGGCCAGCGCCAGGGTGCAGGACCTGATCGGGCTCATCTGCTGGCAGTATACAA
  GCGAAGGACGGGAGCCGAAGCTCAATGACAATGTCAGTGCCTACTGCCTGCATATTGCTGAGGATGATGG
  GGAGGTGGACACCGATTTCCCCCCGCTGGATTCCAATGAGCCCATTCATAAGTTTGGCTTCAGTACTTTG
  GCCCTGGTTGAAAAGTACTCATCTCCTGGTCTGACATCCAAAGAGTCACTCTTTGTTCGAATAAATGCTG
  CTCATGGATTCTCCCTTATTCAGGTGGACAACACAAAGGTTACCATGAAGGAAATCTTACTGAAGGCAGT
  GAAGCGAAGAAAAGGATCCCAGAAAGTTTCAGGCCCTCAGTACCGCCTGGAGAAGCAGAGCGAGCCCAAT
  GTCGCCGTTGACCTGGACAGCACTTTGGAGAGCCAGAGCGCATGGGAGTTCTGCCTGGTCCGCGAGAACA
  GTTCAAGGGCAGACGGGGTTTTTGAGGAGGATTCGCAAATTGACATAGCCACAGTACAGGATATGCTTAG
  CAGCCACCATTACAAGTCATTCAAAGTCAGCATGATCCACAGACTGCGATTCACAACCGACGTACAGCTA
  GGTATCTCTGGAGACAAAGTAGAGATAGACCCTGTTACGAATCAGAAAGCCAGCACTAAGTTTTGGATTA
  AGCAGAAACCCATCTCAATCGATTCCGACCTGCTCTGTGCCTGTGACCTTGCTGAAGAGAAAAGCCCCAG
  TCACGCAATATTTAAACTCACGTATCTAAGCAATCACGACTATAAACACCTCTACTTTGAATCGGACGCT
  GCTACCGTCAATGAAATTGTGCTCAAGGTTAACTACATCCTGGAATCGCGAGCTAGCACTGCCCGGGCTG
  ACTACTTTGCTCAAAAACAAAGAAAACTGAACAGACGTACGAGCTTCAGCTTCCAGAAGGAGAAGAAATC
  CGGGCAGCAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001006621
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001006621.1, NP_001006622.1
• RefSeq Size: 2977 bp
• RefSeq ORF: 993 bp
• Locus ID: 79109
• Cytogenetics: 9q33.3
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a protein that is highly similar to the yeast SIN1 protein, a stress-activated protein kinase. Alternatively spliced transcript variants encoding distinct isoforms have been described. Alternate polyadenylation sites as well as alternate 3' UTRs have been identified for transcripts of this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (5), also known as Sin1e, lacks two alternate in-frame exons in the 5' coding region, and uses a downstream start codon, compared to variant 1. The resulting protein (isoform 4), also known as the delta isoform, has a shorter N-terminus, compared to isoform 1. The existence of this isoform has not been confirmed experimentally. Variants 4 and 5 encode the same isoform (4).