PDPN (NM_001006625) Human Untagged Clone
CAT#: SC301086
PDPN (untagged)-Human podoplanin (PDPN), transcript variant 4
"NM_001006625" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | PDPN |
| Synonyms | AGGRUS; GP36; Gp38; GP40; HT1A-1; OTS8; PA2.26; T1A; T1A-2; T1A2; TI1A |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001006625, the custom clone sequence may differ by one or more nucleotides
ATGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCT GGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGAT CTGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTCA AACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAG AAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATC GGCTTCATTGGTGCAATCATCGTTGTGGTTATGCGAAAAATGTCGGGAAGGCCCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001006625 |
| ORF Size | 357 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Reference Data | |
| RefSeq | NM_001006625.1, NP_001006626.1 |
| RefSeq Size | 2646 |
| RefSeq ORF | 357 |
| Locus ID | 10630 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined but it has been proposed as a marker of lung injury. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4), contains a distinct 5' UTR and has multiple differences in the coding region, compared to variant 1. The resulting isoform (d) is shorter and has a shorter N-terminus when compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224863 | PDPN (Myc-DDK-tagged)-Human podoplanin (PDPN), transcript variant 4 |
USD 420.00 |
|
| RG224863 | PDPN (GFP-tagged) - Human podoplanin (PDPN), transcript variant 4 |
USD 460.00 |
|
| RC224863L3 | Lenti-ORF clone of PDPN (Myc-DDK-tagged)-Human podoplanin (PDPN), transcript variant 4 |
USD 620.00 |
|
| RC224863L4 | Lenti-ORF clone of PDPN (mGFP-tagged)-Human podoplanin (PDPN), transcript variant 4 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China