CHRM2 (NM_001006630) Human Untagged Clone
CAT#: SC301091
CHRM2 (untagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1
"NM_001006630" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CHRM2 |
Synonyms | HM2 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001006630, the custom clone sequence may differ by one or more nucleotides
ATGAATAACTCAACAAACTCCTCTAACAATAGCCTGGCTCTTACAAGTCCTTATAAGACATTTGAAGTGG TGTTTATTGTCCTGGTGGCTGGATCCCTCAGTTTGGTGACCATTATCGGGAACATCCTAGTCATGGTTTC CATTAAAGTCAACCGCCACCTCCAGACCGTCAACAATTACTTTTTATTCAGCTTGGCCTGTGCTGACCTT ATCATAGGTGTTTTCTCCATGAACTTGTACACCCTCTACACTGTGATTGGTTACTGGCCTTTGGGACCTG TGGTGTGTGACCTTTGGCTAGCCCTGGACTATGTGGTCAGCAATGCCTCAGTTATGAATCTGCTCATCAT CAGCTTTGACAGGTACTTCTGTGTCACAAAACCTCTGACCTACCCAGTCAAGCGGACCACAAAAATGGCA GGTATGATGATTGCAGCTGCCTGGGTCCTCTCTTTCATCCTCTGGGCTCCAGCCATTCTCTTCTGGCAGT TCATTGTAGGGGTGAGAACTGTGGAGGATGGGGAGTGCTACATTCAGTTTTTTTCCAATGCTGCTGTCAC CTTTGGTACGGCTATTGCAGCCTTCTATTTGCCAGTGATCATCATGACTGTGCTATATTGGCACATATCC CGAGCCAGCAAGAGCAGGATAAAGAAGGACAAGAAGGAGCCTGTTGCCAACCAAGACCCCGTTTCTCCAA GTCTGGTACAAGGAAGGATAGTGAAGCCAAACAATAACAACATGCCCAGCAGTGACGATGGCCTGGAGCA CAACAAAATCCAGAATGGCAAAGCCCCCAGGGATCCTGTGACTGAAAACTGTGTTCAGGGAGAGGAGAAG GAGAGCTCCAATGACTCCACCTCAGTCAGTGCTGTTGCCTCTAATATGAGAGATGATGAAATAACCCAGG ATGAAAACACAGTTTCCACTTCCCTGGGCCATTCCAAAGATGAGAACTCTAAGCAAACATGCATCAGAAT TGGCACCAAGACCCCAAAAAGTGACTCATGTACCCCAACTAATACCACCGTGGAGGTAGTGGGGTCTTCA GGTCAGAATGGAGATGAAAAGCAGAATATTGTAGCCCGCAAGATTGTGAAGATGACTAAGCAGCCTGCAA AAAAGAAGCCTCCTCCTTCCCGGGAAAAGAAAGTCACCAGGACAATCTTGGCTATTCTGTTGGCTTTCAT CATCACTTGGGCCCCATACAATGTCATGGTGCTCATTAACACCTTTTGTGCACCTTGCATCCCCAACACT GTGTGGACAATTGGTTACTGGCTTTGTTACATCAACAGCACTATCAACCCTGCCTGCTATGCACTTTGCA ATGCCACCTTCAAGAAGACCTTTAAACACCTTCTCATGTGTCATTATAAGAACATAGGCGCTACAAGGTA A |
Restriction Sites | NotI-NotI |
ACCN | NM_001006630 |
Insert Size | 4500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone is found to be a perfect match to NM_001006630.1. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001006630.1, NP_001006631.1 |
RefSeq Size | 2782 bp |
RefSeq ORF | 1401 bp |
Locus ID | 1129 |
Cytogenetics | 7q33 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction, Regulation of actin cytoskeleton |
Gene Summary | 'The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine to these receptors and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 2 is involved in mediation of bradycardia and a decrease in cardiac contractility. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1) represents the longest transcript. Variants 1 through 8 encode the same protein (isoform a). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213942 | CHRM2 (Myc-DDK-tagged)-Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1 |
USD 420.00 |
|
RG213942 | CHRM2 (GFP-tagged) - Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1 |
USD 460.00 |
|
RC213942L1 | Lenti ORF clone of Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC213942L2 | Lenti ORF clone of Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC213942L3 | Lenti ORF clone of Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC213942L4 | Lenti ORF clone of Human cholinergic receptor, muscarinic 2 (CHRM2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review