TCEAL1 (NM_001006640) Human Untagged Clone

CAT#: SC301101

TCEAL1 (untagged)-Human transcription elongation factor A (SII)-like 1 (TCEAL1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TCEAL1
• Synonyms: p21; pp21; SIIR; WEX9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001006640, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACAAACCACGCAAAGAAAATGAAGAAGAGCCGCAGAGCGCGCCCAAGACCGATGAGGAGAGGCCTC
  CGGTGGAGCACTCTCCCGAAAAGCAGTCCCCCGAGGAGCAGTCTTCGGAGGAGCAGTCCTCGGAGGAGGA
  GTTCTTTCCTGAGGAGCTCTTGCCTGAGCTCCTGCCTGAGATGCTCCTCTCGGAGGAGCGCCCTCCGCAG
  GAGGGTCTTTCCAGGAAGGACCTGTTTGAGGGGCGCCCTCCCATGGAGCAGCCTCCTTGTGGAGTAGGAA
  AACATAAGCTTGAAGAAGGAAGCTTTAAAGAAAGGTTGGCTCGTTCTCGCCCGCAATTTAGAGGGGACAT
  ACATGGCAGAAATTTAAGCAATGAGGAGATGATACAGGCAGCAGATGAGCTAGAAGAGATGAAAAGAGTA
  AGAAACAAACTGATGATAATGCACTGGAAGGCAAAACGGAGCCGTCCTTATCCTATTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001006640
• ORF Size: 480 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001006640.1, NP_001006641.1
• RefSeq Size: 1220
• RefSeq ORF: 480
• Locus ID: 9338
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. The encoded protein is similar to transcription elongation factor A/transcription factor SII and contains a zinc finger-like motif as well as a sequence related to the transcription factor SII Pol II-binding region. It may exert its effects via protein-protein interactions with other transcriptional regulators rather than via direct binding of DNA. Multiple family members are located on the X chromosome. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 through 3 encode the same isoform.