TCEAL8 (NM_001006684) Human Untagged Clone

CAT#: SC301115

TCEAL8 (untagged)-Human transcription elongation factor A (SII)-like 8 (TCEAL8), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TCEAL8
• Synonyms: WEX3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001006684, the custom clone sequence may differ by one or more nucleotides
  ATGCAAAAGTCTTGTGAAGAAAATGAGGGAAAACCACAGAACATGCCAAAGGCCGAGGAA
  GATCGCCCTTTGGAGGATGTACCACAGGAGGCAGAAGGAAATCCTCAACCTTCCGAAGAA
  GGCGTAAGCCAGGAAGCAGAAGGAAACCCCAGAGGAGGGCCGAATCAGCCTGGCCAGGGA
  TTTAAAGAGGACACACCCGTTAGGCATTTGGACCCTGAAGAAATGATAAGAGGAGTAGAT
  GAGCTTGAAAGGCTTAGGGAAGAGATAAGAAGAGTAAGAAACAAGTTTGTGATGATGCAT
  TGGAAGCAAAGACATTCACGCAGCCGTCCTTATCCTGTGTGCTTTAGGCCTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001006684
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001006684.1, NP_001006685.1
• RefSeq Size: 1158 bp
• RefSeq ORF: 354 bp
• Locus ID: 90843
• Cytogenetics: Xq22.1
• Gene Summary: This gene encodes a member of the transcription elongation factor A (SII)-like (TCEAL) gene family. Members of this family contain TFA domains and may function as nuclear phosphoproteins that modulate transcription in a promoter context-dependent manner. Multiple family members are located on the X chromosome. Alternative splicing results in multiple transcript variants encoding a single isoform. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same isoform.