GOSR1 (NM_001007024) Human Untagged Clone

CAT#: SC301133

GOSR1 (untagged)-Human golgi SNAP receptor complex member 1 (GOSR1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GOSR1
• Synonyms: GOLIM2; GOS-28; GOS28; GOS28/P28; GS28; P28
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001007024, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTGAGACAATGGCGATTGAGATTGAACAACTTTTGGCAAGGCTTACAGGGGTAAATGATAAAATGG
  CAGAATATACCAACAGTGCAGGTGTCCCCTCCTTGAATGCAGCCCTGATGCATACATTACAGCGGCATAG
  AGACATATTGCAGGATTATACACATGAATTCCATAAAACCAAAGCAAACTTTATGGCAATACGGGAAAGG
  GAGAATCTTATGGGATCAGTACGAAAAGATATTGAGTCATATAAAAGTGGGTCTGGAGTAAACAACAGAA
  GAACTGAGCTATTTTTGAAAGAACATGACCACCTTCGAAACTCAGATCGTCTGATAGAAGAGACAATAAG
  CATTGCTATGGCAACAAAAGAAAATATGACTTCACAGAGAGGAATGTTGAAGTCAATTCACAGCAAAATG
  AACACTTTGGCCAATCGTTTTCCTGCTGTAAACAGCCTGATCCAGAGGATCAACCTGAGGAAGCGGCGGG
  ACTCGCTCATCCTAGGGGGTGTTATTGGGATCTGTACCATCCTGTTGCTGCTGTATGCGTTCCATTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001007024
• ORF Size: 558 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001007024.1, NP_001007025.1
• RefSeq Size: 5246
• RefSeq ORF: 558
• Locus ID: 9527
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• Gene Summary: This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (3) has an additional segment in one exon and lacks a small segment in another exon in the 5' region, as compared to variant 1. It uses a downstream AUG start codon, and the encoded isoform 3 thus has a shorter N-terminus, as compared to isoform 1.