Syntenin (SDCBP) (NM_001007067) Human Untagged Clone

CAT#: SC301139

SDCBP (untagged)-Human syndecan binding protein (syntenin) (SDCBP), transcript variant 2


  "NM_001007067" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SDCBP"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SDCBP
Synonyms MDA-9; MDA9; ST1; SYCL; TACIP18
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001007067, the custom clone sequence may differ by one or more nucleotides


ATGTCTCTCTATCCATCTCTCGAAGACTTGAAGGTAGACAAAGTAATTCAGGCTCAAACTGCTTTTTCTG
CAAACCCTGCCAATCCAGCAATTTTGTCAGAAGCTTCTGCTCCTATCCCTCACGATGGAAATCTCTATCC
CAGACTGTATCCAGAGCTCTCTCAATACATGGGGCTGAGTTTAAATGAAGAAGAAATACGTGCAAATGTG
GCCGTGGTTTCTGGTGCACCACTTCAGGGGCAGTTGGTAGCAAGACCTTCCAGTATAAACTATATGGTGG
CTCCTGTAACTGGTAATGATGTTGGAATTCGTAGAGCAGAAATTAAGCAAGGGATTCGTGAAGTCATTTT
GTGTAAGGATCAAGATGGAAAAATTGGACTCAGGCTTAAATCAATAGATAATGGTATATTTGTTCAGCTA
GTCCAGGCTAATTCTCCAGCCTCATTGGTTGGTCTGAGATTTGGGGACCAAGTACTTCAGATCAATGGTG
AAAACTGTGCAGGATGGAGCTCTGATAAAGCGCACAAGGTGCTCAAACAGGCTTTTGGAGAGAAGATTAC
CATGACCATTCGTGACAGGCCCTTTGAACGGACGATTACCATGCATAAGGATAGCACTGGACATGTTGGT
TTTATCTTTAAAAATGGAAAAATAACATCCATAGTGAAAGATAGCTCTGCAGCCAGAAATGGTCTTCTCA
CGGAACATAACATCTGTGAAATCAATGGACAGAATGTCATTGGATTGAAGGACTCTCAAATTGCAGACAT
ACTGTCAACATCTGGGACTGTAGTTACTATTACAATCATGCCTGCTTTTATCTTTGAACATATTATTAAG
CGGATGGCACCAAGCATTATGAAAAGCCTAATGGACCACACCATTCCTGAGGTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001007067
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001007067.1, NP_001007068.1
RefSeq Size 2170 bp
RefSeq ORF 897 bp
Locus ID 6386
Cytogenetics 8q12.1
Protein Families Druggable Genome, Transmembrane
Gene Summary 'The protein encoded by this gene was initially identified as a molecule linking syndecan-mediated signaling to the cytoskeleton. The syntenin protein contains tandemly repeated PDZ domains that bind the cytoplasmic, C-terminal domains of a variety of transmembrane proteins. This protein may also affect cytoskeletal-membrane organization, cell adhesion, protein trafficking, and the activation of transcription factors. The protein is primarily localized to membrane-associated adherens junctions and focal adhesions but is also found at the endoplasmic reticulum and nucleus. Alternative splicing results in multiple transcript variants encoding different isoforms. Related pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Jan 2017]'
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same, longest isoform (isoform 1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.