DEPDC5 (NM_001007188) Human Untagged Clone
CAT#: SC301164
DEPDC5 (untagged)-Human DEP domain containing 5 (DEPDC5), transcript variant 2
"NM_001007188" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DEPDC5 |
Synonyms | DEP.5; FFEVF; FFEVF1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001007188, the custom clone sequence may differ by one or more nucleotides
ATGAGAACAACAAAGGTCTACAAACTCGTCATCCACAAGAAGGGCTTTGGGGGCAGTGATGATGAGCTAG TTGTGAACCCCAAAGTGTTCCCTCACATCAAGCTTGGAGACATTGTAGAGATTGCACACCCCAACGATGA ATACAGCCCTCTGCTTTTGCAGGTCAAGTCTCTTAAGGAAGATTTACAGAAGGAAACTATCAGTGTGGAC CAGACTGTGACTCAAGTGTTCCGGCTGAGACCTTATCAGGATGTCTATGTTAATGTCGTAGACCCTAAGG ATGTGACCCTTGACCTAGTGGAATTAACTTTTAAGGATCAGTATATTGGCCGTGGGGATATGTGGCGACT AAAGAAAAGTTTGGTCAGCACATGTGCCTATATCACCCAGAAGGTGGAGTTTGCTGGCATCAGAGCACAG GCTGGTGAACTGTGGGTTAAGAATGAGAAGGTCATGTGTGGCTACATCAGTGAAGATACCAGGGTGGTGT TTCGTTCTACGTCGGCTATGGTTTACATATTTATTCAGATGAGCTGTGAAATGTGGGATTTTGATATTTA TGGGGATTTGTATTTTGAGAAAGCTGTGAATGGTTTCCTTGCTGATCTATTTACCAAGTGGAAGGAGAAG AACTGTAGTCATGAAGTGACAGTGGTCCTGTTTTCTAGAACTTTCTATGATGCAAAATCTGTTGATGAAT TTCCTGAAATAAACCGAGCCTCAATTCGACAGGATCACAAGGGGAGATTCTATGAAGACTTTTACAAAGT GGTGGTGCAGAATGAGAGAAGAGAAGAATGGACTTCACTTCTCGTAACCATTAAAAAACTCTTCATCCAG TATCCAGTGTTGGTGCGACTGGAACAGGCAGAGGGCTTTCCTCAAGGAGATAATTCTACCTCAGCACAAG GAAACTACCTGGAGGCCATCAATCTGTCATTCAATGTGTTTGATAAGCACTACATCAACCGCAACTTTGA CCGAACTGGGCAGATGTCAGTGGTGATCACGCCCGGGGTGGGTGTCTTTGAAGTGGACCGCCTACTCATG ATCCTGACCAAGCAGCGGATGATAGATAATGGAATTGGTGTGGATTTGGTGTGCATGGGAGAGCAACCGT TACATGCTGTCCCATTGTTCAAGCTCCATAATCGGAGTGCTCCCCGTGATTCTCGTCTGGGCGATGACTA TAATATCCCTCACTGGATAAACCACAGTTTCTACACATCCAAAAGCCAGCTCTTTTGTAATAGTTTCACC CCACGAATAAAACTGGCAGGAAAGAAGCCCGCCTCTGAGAAAGCAAAAAATGGCCGTGATACATCTCTCG GGAGTCCAAAAGAATCTGAGAACGCCCTTCCCATCCAAGTAGATTATGACGCCTATGACGCTCAAGTGTT CAGGCTGCCCGGCCCATCCCGGGCCCAGTGCCTCACCACCTGCAGATCTGTGCGAGAGCGAGAGAGTCAC AGTCGAAAGAGTGCCAGCTCCTGTGATGTTTCATCCAGCCCTTCCCTACCAAGCCGCACACTGCCCACTG AGGAAGTGAGGAGCCAGGCTTCTGACGACAGCTCCCTAGGCAAGAGTGCCAACATCCTGATGATCCCACA CCCCCACCTGCACCAGTATGAAGTCAGCAGCTCCTTGGGATACACCAGCACTCGAGAGCACCTAGGATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007188 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001007188.2, NP_001007189.1 |
RefSeq Size | 2460 bp |
RefSeq ORF | 1680 bp |
Locus ID | 9681 |
Cytogenetics | 22q12.2-q12.3 |
Gene Summary | This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (2) lacks a large portion of the 3' coding region and has a different 3' structure compared to variant 4. The encoded protein (isoform 2) has a distinct C-terminus and is shorter than isoform 4. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211462 | DEPDC5 (Myc-DDK-tagged)-Human DEP domain containing 5 (DEPDC5), transcript variant 2 |
USD 480.00 |
|
RG211462 | DEPDC5 (GFP-tagged) - Human DEP domain containing 5 (DEPDC5), transcript variant 2 |
USD 530.00 |
|
RC211462L1 | Lenti ORF clone of Human DEP domain containing 5 (DEPDC5), transcript variant 2, Myc-DDK-tagged |
USD 680.00 |
|
RC211462L2 | Lenti ORF clone of Human DEP domain containing 5 (DEPDC5), transcript variant 2, mGFP tagged |
USD 680.00 |
|
RC211462L3 | Lenti ORF clone of Human DEP domain containing 5 (DEPDC5), transcript variant 2, Myc-DDK-tagged |
USD 680.00 |
|
RC211462L4 | Lenti ORF clone of Human DEP domain containing 5 (DEPDC5), transcript variant 2, mGFP tagged |
USD 680.00 |
{0} Product Review(s)
Be the first one to submit a review