SPOP (NM_001007229) Human Untagged Clone
CAT#: SC301171
SPOP (untagged)-Human speckle-type POZ protein (SPOP), transcript variant 6
"NM_001007229" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SPOP |
Synonyms | BTBD32; NEDMACE; NEDMIDF; NSDVS1; NSDVS2; TEF2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001007229, the custom clone sequence may differ by one or more nucleotides
ATGTCAAGGGTTCCAAGTCCTCCACCTCCGGCAGAAATGTCGAGTGGCCCCGTAGCTGAGAGTTGGTGCT ACACACAGATCAAGGTAGTGAAATTCTCCTACATGTGGACCATCAATAACTTTAGCTTTTGCCGGGAGGA AATGGGTGAAGTCATTAAAAGTTCTACATTTTCATCAGGAGCAAATGATAAACTGAAATGGTGTTTGCGA GTAAACCCCAAAGGGTTAGATGAAGAAAGCAAAGATTACCTGTCACTTTACCTGTTACTGGTCAGCTGTC CAAAGAGTGAAGTTCGGGCAAAATTCAAATTCTCCATCCTGAATGCCAAGGGAGAAGAAACCAAAGCTAT GGAGAGTCAACGGGCATATAGGTTTGTGCAAGGCAAAGACTGGGGATTCAAGAAATTCATCCGTAGAGAT TTTCTTTTGGATGAGGCCAACGGGCTTCTCCCTGATGACAAGCTTACCCTCTTCTGCGAGGTGAGTGTTG TGCAAGATTCTGTCAACATTTCTGGCCAGAATACCATGAACATGGTAAAGGTTCCTGAGTGCCGGCTGGC AGATGAGTTAGGAGGACTGTGGGAGAATTCCCGGTTCACAGACTGCTGCTTGTGTGTTGCCGGCCAGGAA TTCCAGGCTCACAAGGCTATCTTAGCAGCTCGTTCTCCGGTTTTTAGTGCCATGTTTGAACATGAAATGG AGGAGAGCAAAAAGAATCGAGTTGAAATCAATGATGTGGAGCCTGAAGTTTTTAAGGAAATGATGTGCTT CATTTACACGGGGAAGGCTCCAAACCTCGACAAAATGGCTGATGATTTGCTGGCAGCTGCTGACAAGTAT GCCCTGGAGCGCTTAAAGGTCATGTGTGAGGATGCCCTCTGCAGTAACCTGTCCGTGGAGAACGCTGCAG AAATTCTCATCCTGGCCGACCTCCACAGTGCAGATCAGTTGAAAACTCAGGCAGTGGATTTCATCAACTA TCATGCTTCGGATGTCTTGGAGACCTCTGGGTGGAAGTCAATGGTGGTGTCACATCCCCACTTGGTGGCT GAGGCATACCGCTCTCTGGCTTCAGCACAGTGCCCTTTTCTGGGACCCCCACGCAAACGCCTGAAGCAAT CCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007229 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001007229.1, NP_001007230.1 |
RefSeq Size | 2982 bp |
RefSeq ORF | 1125 bp |
Locus ID | 8405 |
Cytogenetics | 17q21.33 |
Gene Summary | This gene encodes a protein that may modulate the transcriptional repression activities of death-associated protein 6 (DAXX), which interacts with histone deacetylase, core histones, and other histone-associated proteins. In mouse, the encoded protein binds to the putative leucine zipper domain of macroH2A1.2, a variant H2A histone that is enriched on inactivated X chromosomes. The BTB/POZ domain of this protein has been shown in other proteins to mediate transcriptional repression and to interact with components of histone deacetylase co-repressor complexes. Alternative splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) differs in the 5' UTR compared to variant 1. Transcript variants 1-6 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201551 | SPOP (Myc-DDK-tagged)-Human speckle-type POZ protein (SPOP), transcript variant 6 |
USD 420.00 |
|
RG201551 | SPOP (GFP-tagged) - Human speckle-type POZ protein (SPOP), transcript variant 6 |
USD 460.00 |
|
RC201551L1 | Lenti ORF clone of Human speckle-type POZ protein (SPOP), transcript variant 6, Myc-DDK-tagged |
USD 768.00 |
|
RC201551L2 | Lenti ORF clone of Human speckle-type POZ protein (SPOP), transcript variant 6, mGFP tagged |
USD 620.00 |
|
RC201551L3 | Lenti ORF clone of Human speckle-type POZ protein (SPOP), transcript variant 6, Myc-DDK-tagged |
USD 620.00 |
|
RC201551L4 | Lenti ORF clone of Human speckle-type POZ protein (SPOP), transcript variant 6, mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review