DUSP13 (NM_001007272) Human Untagged Clone

CAT#: SC301205

DUSP13 (untagged)-Human dual specificity phosphatase 13 (DUSP13), transcript variant 2


  "NM_001007272" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DUSP13"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DUSP13
Synonyms BEDP; DUSP13A; DUSP13B; MDSP; SKRP4; TMDP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001007272, the custom clone sequence may differ by one or more nucleotides


ATGGCTGAGACCTCTCTCCCAGAGCTGGGGGGAGAGGACAAAGCCACGCCTTGCCCCAGCATCCTGGAGC
TGGAGGAGCTCCTGCGGGCAGGGAAGTCTTCTTGCAGCCGTGTGGACGAAGTTTGGCCCAACCTTTTCAT
AGGAGATGCGATGGACTCACTGCAGAAGCAGGACCTCCGGAGGCCCAAGATCCATGGGGCAGTCCAGGCA
TCTCCCTACCAGCCGCCCACATTGGCTTCGCTGCAGCGCTTGCTGTGGGTCCGTCAGGCTGCCACACTGA
ACCATATCGATGAGGTCTGGCCCAGCCTCTTCCTGGGAGATGCGTACGCAGCCCGGGACAAGAGCAAGCT
GATCCAGCTGGGAATCACCCACGTTGTGAATGCCGCTGCAGGCAAGTTCCAGGTGGACACAGGTGCCAAA
TTCTACCGTGGAATGTCCCTGGAGTACTATGGCATCGAGGCGGACGACAACCCCTTCTTCGACCTCAGTG
TCTACTTTCTGCCTGTTGCTCGATACATCCGAGCTGCCCTCAGTGTTCCCCAAGGCCGCGTGCTGGTACA
CTGTGCCATGGGGGTAAGCCGCTCTGCCACACTTGTCCTGGCCTTCCTCATGATCTGTGAGAACATGACG
CTGGTAGAGGCCATCCAGACGGTGCAGGCCCACCGCAATATCTGCCCTAACTCAGGCTTCCTCCGGCAGC
TCCAGGTTCTGGACAACCGACTGGGGCGGGAGACGGGGCGGTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001007272
ORF Size 747 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001007272.1, NP_001007273.1
RefSeq Size 1063
RefSeq ORF 747
Locus ID 51207
Protein Families Druggable Genome, Phosphatase
Gene Summary Members of the protein-tyrosine phosphatase superfamily cooperate with protein kinases to regulate cell proliferation and differentiation. This superfamily is separated into two families based on the substrate that is dephosphorylated. One family, the dual specificity phosphatases (DSPs) acts on both phosphotyrosine and phosphoserine/threonine residues. This gene encodes different but related DSP proteins through the use of non-overlapping open reading frames, alternate splicing, and presumed different transcription promoters. Expression of the distinct proteins from this gene has been found to be tissue specific and the proteins may be involved in postnatal development of specific tissues. A protein encoded by the upstream ORF was found in skeletal muscle, whereas the encoded protein from the downstream ORF was found only in testis. In mouse, a similar pattern of expression was found. Multiple alternatively spliced transcript variants were described, but the full-length sequence of only some were determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks several internal exons, compared to variant 1. The encoded protein, isoform 2 (also called TMDP-L2) has an alternate C-terminus, compared to isoform 1. Efforts to detect expression of isoform 2 were unsuccessful.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.