RWDD1 (NM_001007464) Human Untagged Clone
CAT#: SC301212
RWDD1 (untagged)-Human RWD domain containing 1 (RWDD1), transcript variant 3
"NM_001007464" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RWDD1 |
Synonyms | CGI-24; PTD013 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001007464, the custom clone sequence may differ by one or more nucleotides
ATGGTGATGATTTTTACTCTAGTGACAGCTGTGCAAGAAAAATTAAATGAAATAGTAGATCAGATAAAAA CTAGAAGAGAAGAAGAAAAGAAACAAAAAGAAAAAGAAGCAGAAGAAGCTGAAAAGCAATTATTCCATGG TACTCCAGTTACAATTGAGAATTTCTTAAATTGGAAAGCCAAGTTTGATGCAGAACTCTTGGAAATTAAA AAGAAAAGGATGAAAGAAGAAGAACAAGCAGGAAAAAATAAATTAAGTGGGAAACAACTATTTGAAACAG ATCATAATCTTGACACATCTGATATCCAGTTCTTGGAGGATGCTGGAAACAACGTGGAGGTAGATGAGTC TTTGTTCCAAGAAATGGATGACTTGGAGCTGGAGGATGATGAAGATGATCCAGACTATAATCCTGCTGAC CCAGAGAGTGACTCAGCTGACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001007464 |
ORF Size | 444 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001007464.2, NP_001007465.1 |
RefSeq Size | 1562 |
RefSeq ORF | 444 |
Locus ID | 51389 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221813 | RWDD1 (Myc-DDK-tagged)-Human RWD domain containing 1 (RWDD1), transcript variant 3 |
USD 420.00 |
|
RG221813 | RWDD1 (GFP-tagged) - Human RWD domain containing 1 (RWDD1), transcript variant 3 |
USD 460.00 |
|
RC221813L3 | Lenti ORF clone of Human RWD domain containing 1 (RWDD1), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC221813L4 | Lenti ORF clone of Human RWD domain containing 1 (RWDD1), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review