HCST (NM_001007469) Human Untagged Clone

CAT#: SC301216

HCST (untagged)-Human hematopoietic cell signal transducer (HCST), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HCST
• Synonyms: DAP10; KAP10; PIK3AP
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001007469, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATCCATCTGGGTCACATCCTCTTCCTGCTTTTGCTCCCAGTGGCTGCAGCTCAGACGACTCCAGGAG
  AGAGATCATCACTCCCTGCCTTTTACCCTGGCACTTCAGGCTCTTGTTCCGGATGTGGGTCCCTCTCTCT
  GCCGCTCCTGGCAGGCCTCGTGGCTGCTGATGCGGTGGCATCGCTGCTCATCGTGGGGGCGGTGTTCCTG
  TGCGCACGCCCACGCCGCAGCCCCGCCCAAGATGGCAAAGTCTACATCAACATGCCAGGCAGGGGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001007469
• ORF Size: 279 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001007469.1, NP_001007470.1
• RefSeq Size: 521
• RefSeq ORF: 279
• Locus ID: 10870
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Natural killer cell mediated cytotoxicity
• Gene Summary: This gene encodes a transmembrane signaling adaptor that contains a YxxM motif in its cytoplasmic domain. The encoded protein may form part of the immune recognition receptor complex with the C-type lectin-like receptor NKG2D. As part of this receptor complex, this protein may activate phosphatidylinositol 3-kinase dependent signaling pathways through its intracytoplasmic YxxM motif. This receptor complex may have a role in cell survival and proliferation by activation of NK and T cell responses. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2).