Myelin oligodendrocyte glycoprotein (MOG) (NM_001008228) Human Untagged Clone

CAT#: SC301268

MOG (untagged)-Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MOG
• Synonyms: BTN6; BTNL11; MOGIG2; NRCLP7
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001008228, the custom clone sequence may differ by one or more nucleotides
  ATGGCAAGCTTATCAAGACCCTCTCTGCCCAGCTGCCTCTGCTCCTTCCTCCTCCTCCTC
  CTCCTCCAAGTGTCTTCCAGCTATGCAGGGCAGTTCAGAGTGATAGGACCAAGACACCCT
  ATCCGGGCTCTGGTCGGGGATGAAGTGGAATTGCCATGTCGCATATCTCCTGGGAAGAAC
  GCTACAGGCATGGAGGTGGGGTGGTACCGCCCCCCCTTCTCTAGGGTGGTTCATCTCTAC
  AGAAATGGCAAGGACCAAGATGGAGACCAGGCACCTGAATATCGGGGCCGGACAGAGCTG
  CTGAAAGATGCTATTGGTGAGGGAAAGGTGACTCTCAGGATCCGGAATGTAAGGTTCTCA
  GATGAAGGAGGTTTCACCTGCTTCTTCCGAGATCATTCTTACCAAGAGGAGGCAGCAATG
  GAATTGAAAGTAGAAGATCCTTTCTACTGGGTGAGCCCTGGAGTGCTGGTTCTCCTCGCG
  GTGCTGCCTGTGCTCCTCCTGCAGATCACTGTTGGCCTCATCTTCCTCTGCCTGCAGTAC
  AGACTGAGAGGAAAACTTCGAGCAGAGATAGAGAATCTCCACCGGACTTTTGAGTCCTTT
  GGTGTTCTAGGACCCCAGGTTAAGGAACCAAAAAAGACAGGGCAATTCCTTGAAGAGCTA
  CGAAATCCCTTCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001008228
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001008228.1, NP_001008229.1
• RefSeq Size: 2050 bp
• RefSeq ORF: 675 bp
• Locus ID: 4340
• Cytogenetics: 6p22.1
• Protein Families: Transmembrane
• Gene Summary: 'The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (alpha3) has multiple differences in the coding region, compared to variant beta1. Alpha type variants use an alternative splice site at the 3' end, compared to isoform beta1. The resulting isoform (alpha3) is shorter and contains a shorter and distinct C-terminus, compared to isoform beta1.